Transcript asmbl_210025

Sequence
Transcript Sequence for observation asmbl_210025 of TGE0006559:
GCCGGGCCGCGAGCGGACAAAAGCCGGGAAAAGGAAAACCCTGCCCTGCGAGTGTGGGTCAATGCGTTTTTGCGGAGGAGGTGTTGGACTGCTAGGGCCCCGCTGAGATTGTCAGTTTGCGCGCTTTTGAGTTTAAGCGTGTGTGGCTGTGGCGACCCCCAGCGCGTCGCCAGCGTACCTTCCTCTGCAGGAGATAAACTGCACTCAGCTGAGTGCAAGATTAAGAGGAATTGATTAGAAGTTGACTCTAAAGGTTTATTGCAGTCAAAATGTCTCAAAAAATCCGTGGTGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAGTTGATTAAAGAAAAACTCATTTTTCCATATGTGGAATTGGACCTGCACAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAATGACCAGGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGTACAATGTTGGTGTCAAGTGTGCTACCATCACCCCCGATGAGAAGAGGGTTGAGGAGTTCAAGCTGAAACAAATGTGGAAGTCACCAAATGGCACCATTCGAAATATTCTGGGTGGCACTGTCTTCAGGGAAGCTATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCCATCATCATAGGTCGTCACGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGTCCTGGAAAAGTAGAGATAACCTACACACCAAGCGATGGATCCCAAAAAAAGACGTACCTGGTTCATAACTTTGAAGAGGGTGGTGGTGTTGCCATGGGGATGTACAATCAAGATAAGTCAATCGAAGAATTTGCACACAGTTCTTTCCAGATGGCTCTGTCTAAGAGTTGGCCTTTATATCTGAGCACCAAGAACACTATTCTGAAGAAATATGATGGACGTTTTAAAGACATCTTTCAGAAGATATATGACAAACAGTACAAATCCCAATTTGAAGCCCAGAAGATCTGGTATGAGCATAGGCTCATCGATGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGTTTTATTTGGGCCTGCAAAAACTATGATGGTGATGTGCAGTCAGACTCCGTGGCCCAAGGTTATGGCTCTCTTGGCATGATGACCAGCGTGCTGATTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCATGGGACTGTAACACGCCACTACCGCATGTACCAGAAGGGACAAGAGACATCCACCAATCCTATTGCCTCCATTTTTGCATGGACCAGAGGGTTAGCCCATAGAGCTAAGCTTGATAACAATAAGGAGCTTGGCTTTTTTGCAAAGGCTTTGGAGGAAGTCTGTATTGAGACCATCGAGGCTGGCTTCATGACCAAGGATTTGGCTGCTTGTATTAAAGGTTTACCCAATGTGAAACGTTCAGACTACTTGAATACATTTGAGTTCATGGACAAACTCGGAGAAAACTTGAAGACAAAACTAGCTCAGGCTAAACTTTAAGGTCATTCCTTGACTTGGGAGGACACGTGTTTTTTTGGTAATTAGGTCCACTGGTTTACATTTTTCTGTATAACACTCAAGAGTATGGGCAAAATCAATTTTCTAATTTGTTTAGAAGTCAGAGTTTATCTTTTCTATAAGATTACAGTCTTTTTCTTATACATACAATTATGCCACCTTCATGAATGTGGCTGGGAACTTTTTAAAATTTTATTTTCTATTAGTAGCTTAGGAATTACTTTAGTGCTGATTTGTACTCACTGTCACTTTTTCTCATGTTCCAGTATAAATGACCAAAATGAAGAGTGCTCGAAAGGGTAAACTATAGCCATGGTATTAGTCCCTAAAATTGTATAAAGTAGAAATTCGCTCCCTTCCCCACTTTTCCATGGCCTGGGGCTCTGGGTGGTTTTGCTGTAACAGGTGTCCCATCCTGTGTGGTAGAGCTGTACCTTAAAAGTTGCCCATGAGTTGGAATGAAGAGCATGGTTATAACTAAGACACAGCAGTCATATATGTAAAGAGCTCTGATTGAACGTTTCGAAAAGGCTAAAGATTTTTGAAGCCACTAAGAGTGTTTGGAATCTAGAATAAATACTACTCGGGGGTTTGTCCTCTGCGTTTGTCTCCTCCTCCTGGCCCTGTGTGGCTTAAGTATTATACTGCCCTGAACAGCATATTTCATCTAAGTGCAATAATACAAGCTGCACCTTTTTTGTACTTCTGCTGGCCTGTTGGGTTTTTTTTTTATATAAATGTGACTTTTTAGAAATTTGTTTTAAACACTATACTAGTCTGTTCTTCATCTAAACTATTAATTAAAGTTAAGTGCTAATGACTAA