Transcript asmbl_209442

Sequence
Transcript Sequence for observation asmbl_209442 of TGE0006510:
GCGCCGACCAATGGGGAGGCGAAGCCCTCCGCGGGGCGGACCGCCGGGGGCGGGGGTGGGTGCGCGCCCCGGATCCCGCTCCGTTGACTTCCGGCGCGCGGCGGGTGCCCGAGCTCGGAGCGCGCAGGTGAGCGTGCGAGTTCGAGCGGCCAGACTGCATTTTGTCGGCATTGTGTCGCTTTCTTTTTCTTTTTGAATTCCTGGTTTGCAGACAGCAATGGCAGCCCGAGTACTTGTAATTGGCAATGGAGGAAGAGAACATACACTGGCTTGGAAACTTGCACAGTCTGATCATGTTAAACAGGTGTTGGTTGCCCCAGGAAATGCAGGCACTGCCTGCTCTGAAAAGATTTCAAATGCTGCCATCTCCATCAGTGATCACAGCGCCCTTGCTCAATTCTGCAAAGATGAGGAAATTGAATTTGTAGTTGTTGGACCAGAGGCACCTCTGGCTGCTGGAATTGTTGGGAACCTGACATCTGCAGGAGTGCGATGCTTTGGCCCCACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGATTTGCCAAGGAGTTTATGGATCGACATGGAATCCCAACTGCACAATGGAGAGCTTTCACCAAACCTGAAGAGGCCTGCAGCTTCATTATGAGTGCCAGCTTCCCTGCTTTGGTTGTGAAGGCCAGTGGTCTTGCAGCTGGGAAAGGGGTGATTGTTGCAAAGAGCAAAGAAGAGGCCTGCAAAGCTGTACAGGAGATCATGCAGGATAAAGCTTTTGGAGCAGCTGGAGAAACAGTTATCATTGAAGAACTTCTTGAAGGAGAAGAAGTGTCTTGTCTGTGCTTCACTGATGGAAGGACTGTGGCCCCCATGCCCCCAGCACAGGACCATAAGCGATTGCTAGAAGGAGATCACGGCCCCAACACCGGGGGAATGGGAGCCTATTGCCCAGTACCTCAGGTTTCTAAGGATTTGTTGCTAAAAATTAAAAATATCATTCTTCAGAGGACAGTGGATGGCATGCAGCAAGAGGGTACGCCATACACAGGTGTTCTCTATGCTGGTATAATGCTGACTAAGGATGGCCCAAGAGTTCTGGAGTTTAATTGCCGTTTCGGTGATCCAGAGTGCCAAGTCATCCTCCCACTTCTTAAAACTGATCTTTATGAAGTGATTCAGTCTACCTTAGATGGCCTGCTGTGTACCTCTCTGCCTGTTTGGCTTGAAAATCACACTGCTATAACTATTGTCATGGCAAGTAAAGGTTATCCAGGAGACTACACCAAGGGTGTGGAGATAACAGGGTTTTCTGAGGCTCAGGCTTTGGGACTGGAGGTGTTCCAAGCAGGTACTGCCCTAAAAGATGGCAAAGTGGTGACTAATGGTGGTAGAGTCCTTACAGTAACAGCCATCCAGGAAAATCTCATCTCAGCCCTTGAAGAAGCCAAGAAAGGACTAGCTGCTATAAAGTTTGAGGGAGCCATTTACAGAAGGGACATCGGCTATCGTGCCATAGCTTTCCTTCAGCAGCCCAGGGGCCTGACTTATAAGGAATCTGGGGTAGACATTGCAGCTGGAAATATGCTGGTCAGGAAAATTAAACATTTAGCAAAAGCCACCTCTAGACCAGGCTGTGATGTTGATCTTGGAGGTTTTGCTGGTCTTTTTGATTTGAAAGCAGCTGGTTTCAAAGATCCTCTTTTGGCCTGTGGAACAGATGGTGTTGGAACAAAACTGAAGATTGCCCAGCAGTGCAATAAACATGATACCATTGGTCAGGATTTGGTTGCAATGTGTGTAAATGATATTCTGGCACAAGGAGCAGAGCCCCTCTTCTTCCTTGATTACTTTGCCTGTGGAAAACTTGACCTCGATACAACTGAAGCAGTTGTTGCTGGAATTGCTAAAGCCTGTGGAAAAGCTGGATGTGCTCTCCTTGGTGGCGAAACAGCAGAAATGCCTGACATGTATACTCCAGGAGAGTATGACCTAGCCGGTTTTGCCGTCGGTGCCATGGAGCGGCATCAGAAACTCCCTCATCTGGAAAGAATCGCCGAAGGGGATGTTGTCATTGGAATAGCTTCATCTGGTCTTCACAGCAATGGGTTTAGCCTCGTGAGGAAAATTGTAGCGAAATCTTCCCTTCAGTACTCCTCCCCAGCACCCGATGGCTGCGGTGACCAGACATTAGGAGACTTGCTTCTAACTCCAACCAGAATCTACAGCCATTCACTCTTACCTGTATTACGTTCAGGACACGTCAAGGCCTTTGCCCACATTACTGGTGGAGGATTGCTAGAAAACATCCCCAGAGTCCTCCCTCAGAAATTTGCGGTGGATTTAGATGCCCAGACCTGGAGGATCCCCAGGATCTTCTCGTGGTTACAGCAGGAAGGACAGCTGTCTGAAGAAGAGATGGCCAGAACATTTAACTGTGGGGTTGGGGCTGCCCTCGTGGTATCAAAGGACGTGACAAAGCAGATTCTGAAGGATATTCAGCAGCACCAGGAAGAAGCTTGGGTGATTGGCAGGGTGGTGGCATGTCCTGAAGGTTCTCCTCGTGTGAAAGTCAGGCACCTAATCGAAGCCATGCAGATAAATGGATCAGTATTGGAGAATGGCACCCTGAAAAGCCATTTCACTGCCCAACCAAAAAAGGCAAGAGTGGCTGTCTTAATATCTGGAACAGGATCCAACCTCCAAGCTCTGATAGACAGCACTCGGGAGCCGAGCAGCTGTGCACACATTGTTGTCGTCGTCTCCAACAAAGCAGCGGTGGCTGGCTTAGATAAAGCAGCGAGAGCTGGAATTCCTACCAGAGTAATTAATCATAACTTATATAAAAGTCGTGTAGAATTTGACACTGCAATTGACCAAGTCCTTGAAGAGTTCTCCACAGACATAGTCTGTCTCGCAGGATTCATGAGAATTTTATCTGGCCCCTTTGTCAGAAAATGGAATGGGAAAATGCTCAACATCCACCCTTCCTTGCTCCCTTCTTTTAAGGGGTCAAATGCCCACGAGCAAGCCCTGGGTGCCGGTGTCAAAGTAACTGGGTGCACGGTGCACTTTGTAGCTGAAGAAGTAGATGCTGGACAAATTATTTTGCAAGAAGCTGTTCCTGTGAAGAGGGGTGACACTGTTGCAACTCTGTCTGAAAGAGTGAAATCAGCAGAGCATAAAATATTTCCCGCAGCCCTCCAGCTGGTGGCCAGTGGAACTGTGTGGCTTGGAGAAAATGGCAAACTCTGTTGGGTTAAGGAGAAATGAAGCTGCCTAATTCAGGAATGGAGCCAGTTTTGAAAGAAGTCTAGCTGTTTACATGGTGGCTTTTTTATCATAGACTCGTCCCAAAATAATGGCTGAAAAAGAGGACCTCACCCTTATTTCTTTGGCTGTTTTTTACATGAACAAAAATTCATTCCAAGCAAGACTGGTGCAGCATATCTAAGATATATATCTGCTTCATTGGTCTTCCAGGTTTTACCTGTTTACGACCTTGTTCAGAATCAAGCTAGTCATTCAGAACACCTTTCATTTTCAGCCAGATACTAAAATTCTTACTCTTTCTTTTTCTGACCAATATTTTTTTTTAGTTATATGTTTTCTAATCTTTGAAGAGTTAACCAACAAGTCTAATAATAAATTAATCTCTCTGTTGTTTTGAAGTGAGACTTCTCTTATTATCCTGATCATAATTTAGTGTCATAAAATTTCTGGGTAGCTCCCATTTCTGAGGGGTTGTATCTTTTCCTTTAAAATATCATTAAACATCCCTCTAATAATTGACAGTTTCTGTAATACCAAGATTTTAACTGCATAGTTACTCTATGGATTATGTACATCCATACTTTTATGAATCAGTGGAGGGCTAAAGGGAGAGTTTTGGTGGCCTCTAGATTCAAACATAAGACTTGAAGCAGGTTACTCATCTACTCTGTTTCCCCATCTGCTAAAGTAGGCAAATGTCTACCACATGATTGTTTTGATGATTAAATTTAGTGCATTTGATAATTAAATTTAGTCCAATAAACACCAACCTCTGAGCACCTACT