Transcript asmbl_209424

Sequence
Transcript Sequence for observation asmbl_209424 of TGE0006507:
AGCGCATGCGTGCTCCGCGCGCGTGGTAGCGCGAGGGAAGACAGGACCCGGCGGGAGCTTGGGAGAGCGCGCGTGCGCCGTCGCGAGCTCGGCGCTGCCGGGCAGCCGTGTGGGAGCGGGTGTGAGACCGCCGTGCGGGCCGCGGGAATGTTCCGAAAGGCCCGGCGAGTGAACGTGCGCAAGCGGAATGACTCGGAGGAGGAGGAGCGAGAGCGCGATGAGGAGCAGGAGCCGCCGCCGTTGTTGCCGCCGCCCGGCACTGGAGAAGAGCCGGGCCCCGGCGGCAGCGACAGGGCCCCCGGGGGAGAGTCGCTACTGGGCCCCGGGCTGCCACCGCCTTCTGCACTGACCCCAGGGCCCGGGGCCGAGGCCGGGAGCTGCTTCCCGGGCGGCGCGGAACCTGGCAACGGGCTGAAGCAGCGCAAGAGGCCGCGCGAGAACAAAGAAGTGCCCCGGGCCAGCCTGCTCAGCTTCCAGGACGAGGAGGAAGAAAATGAAGAAGTTTTTAAAGTGAAGAAATCAAGTTATAGCAAAAAGATTGTAAAATTACTTAAGAAAGAATATAAAGAAGATCTTGAAAAATCAAAGATTAAGACAGATGTCAACTCATCAGCTGACAATGAACCACCTTTGGACAAAACAGGACATGTTAAGGACACCAGTCAAGAAGATGGAGTTATTATTAGTGAACATGGTGAAGATGAAATGGATATGGAAAGTGAGAAGGAAGAAGAAAAGCCCAAGGCTGGGGGAGCCTTTTCAAATGCTTTATCTTCTTTGAATGTTCTCCGTCCAGGAGAAATTCCAGATGCAGCTTTCATACATGCTGCAAGGAAAAAGCGTCAGATGGCCCGGGAATTGGGAGATTTCACTCCTCATGATAGTGAGCCTGGTAAAGGCCGCCTTGTTAGAGAAGATGAGAATGATGCCAGCGATGATGAAGATGATGATGAGAAACGCCGTATAGTATTTTCTGTGAAAGAAAAGTCTCAAAGACAAAAAATTGCCGAGGAAATAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTAGGGCAGATCAATGTCTTAAAGACCTGTCCTCTAGCTTTGTGTTCCCTCAGGCAACATGTAGTCTGGGGTAGCAGATGCAGACTATCAGCAAAGAAGATTCACTGGCCCATCTTCAAAAGCTAAACAGAAGATGACTTCATCCTTTGTTCTGCTACCTGCTTGGATTACTTCTGTGGAAGCCTTGAAAAGTTTTTTAGAATGCCACTCCATGATCTTGTTGAAGACAGTTCTGAGTTTGCACCTCTTGGACTCTGAAAAAGTGTAGTCAAGATATGGGGGGAAAAGCAAAACAGTGAGATTTTGGTTAGCCCATCAAAAAACTTTATATGAAGTCTGTAAACTGCCAATTTTTTGAGAAAAAAGCAGTACAGATGAAAAGATGCCACACCAAGTATTTTTATATTCTAATAGTGGAACTAAATGCGTTATAATATTGCAAGAGTCCTGACAGCATAAATTTTGTGGTGTAAATATGTTATATTTATCCTTTTGTGTTCTTAAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGCTTTAGCCAAGCATTAAATTAATTTTCAATTATATCCTTTGTTGTATTTTGCTGATTAGTTTTAGTCAAGAGCATTTCAAATCAGTTTAATATAGTGAGACTGGTAGTATGTGTATCCTGGTCAACTCAAATATTTAGAAGAGTGTCATGCATTCTAGTTGCTGTCAGTTTTTATTTTAGGACCACGGCTTATTGATTCTGAATGAATTTTTTGTTACACCTTAGTGGCCCACTAAAAATTTAGATGAGATCACTTATTTCCAACTTCAGAGGAATGAAACATTGAAACATGTACATATAGAACATGCACATCATTTGTGTGTTAAATTTGTATTTCCAAACCCATAGACTGATTTCTTATGTCTGCTTTTAAGGATGCTTGCAGTGAACTTTGGGACTTTTAATCTTATGAAATCCATTAGGCTGCTTTGGTTTCAGGAATGTGTTTGCACACTACAGCACAACTTTGATACAAAGCGAATTTAGCATAGACTTGTGCATAAGGCAAGTGATTCTCTTCGCAGCCAGAAAACTTTTATTTCTGAAATAGCTAAAGGACATCCTTTCTTATGAAGGGAATTGTGAAAAGATAAATTCAGAGGGTGACATTTTAATAAAGCTGAAGTTTTGTCTTCTAAA