Transcript asmbl_209423

Sequence
Transcript Sequence for observation asmbl_209423 of TGE0006507:
AATAAATGAATTCCCTTGCTCTTGTGTTAGATCGAAAAATTATAACAGCATGTACTTGGGTTTTGTTTAAGGAAATATAGCTTTGCAAAGGAGCTCAAAAACCTGCACTAATATGCTGTCAGTCTTATTCTTCTTTGTACATTTTGTTTATTCTTTAGAGTTAGAAAAATATCATTATTTCATCTTAAAACCACTATCTGTTTGGCCCTAATAGATTTTTTCTTCCTGTTTTCATCCTCTTCATAACATGAATACAAATTCTGTTATTGATCACAGTGAAAGATTTTGAGTTTAGGACGAGAATTTTGGAGTGCAGAGGGGGTTTTATTACGTAACAAATGATACAACTTCAAGATTGGGGGAATTTTGAGCTTCACTCCTTGGGTAAAGGAAAATTTTTTTGGATTTAAAATTTTTTGTATTTTCTAGTTTGTCTTATACACTATACTGAGTTTTTTTAGTAAGTCAGTTGATGCCTACAGTTCTTGAAATATTAGTGTAAAAACTTAGAAATTGAATTTATATTCCTTTCATTATGATGTGTTTTAGGGAAAACCAAAATTAATTGGAGACCTCTTATTAGTTAGCTGAGATTCTTTAAGCAGGCATTTTAAACCTTTTAATTCATTTTTCCAGTGCCCTCCACATTCTTGGGTGCTCTAATAGGAATATTCCCAGCATGGGTTTCTTGTGGCTTCTTTCGTCATCTCTTTGTTCCCTATCAGCAGTTCTCAGATGGAAATGTACATCAGAATTACCCGTGATATTAATTTAAAGTGCAGATTTCCTGGTCCTTCTCTCAGAGATTCTTGCAGGTCTTGGATGGTGTCCAGTAATCTGCATGTTAAAAAACCACTCCAGGTTATCCAAGTGGAAAGGGCCCTTGTGTTATCTTTTCTAAAAACAATGCTTTGTCATGTAGCGTGTCCTCTAAAGTAGAGAGACATTAGATCCCTGAGGAAGCATCCTTCTGTGTGCCTGGTGGGTTTTGGAGCATCATAAAGAGGTGGTAATATGACCCTCAAAGCTGAATCGGACTGAGATGTGGGCCATGTGAATGGCTTTGACTTTCTATTTTTGCCACATATGTTTAAATTGGAGTATTGCTCTATTGGGCACCTAAATGACTAATGCATCCCTCCCAGATCACTCTCTTTCGATCCAGACAGAACCAGATTTCTGGGGCAGATTACAGGTAACCATTGTACCTACTAAGGGAAGTAATTTTCTTTTAAGTTAAATGGTTTGTGTGTTCTGTACATTTCATCAAATACCTTTTCTTGCCTATAATCTGTTCTTTGTAATTTGGAGCTATTTACTTGTATGGAATTAGAAGTAAGGGTTGAATGGCGTATGTTAATTAGATCGAGAGCTGGAAAGAAATTGAAAGGTAATGAAAAAGTGAAAAATGCTGCCCTAGATGGGAGTATTCATTAATTGTCAAAGATTTGAGGAAAATTATGTGGGACACTGAGGTATCAGTTCCATTTCCATTCTTTTTTTAAAGCCTGAAATTCATCTCTTTAGATTTGTAAACACCACAAATACATAGTTCTCACAGAAATGGAGACTCACACTTGAGCCATCTACTCTCTCATATCTCCTTCAATACATGTTTTATCAACTATATAAACATAGTAGCATTTTAAGTATTATAGTAATGAATGTTCTTTAAAATATTTCTTTAATGAATGATACCTCTTAAGAGGCAGGAATCATTTCTCTAGTTTGGGATTTTTTTAGCTAATTCATCTGTGGTGTGTAGTGAACTCACAGTTGAGGTAAAACTGGGGCATCTTTTTATGTACTAACCTTTCTTTATAATTTGTGTGCTCTGGAACATACTTCCTAATATCTGAGCAATTTTGAAATATGAATGAAAAATTCAGTAAGAAAGCCAACTTAAAAAATAGTGGGGTTTAGAATAGTTAGGATATACTGAAGTGTAGAGAGCTAATATTTGGTTTTATTTTTCCTGTTGCTGCTATTGGTGACACGTCGGGGAAAAATTTGCAAAAGACTTTCTTTGATTTTGCATGTGATTTCCCCCCACTTCTGTCCCTGGAGTTGTTTACTTCCCTTTGGTAAACATATACAAGAGGTCCTCAAATATAAGAGGTCCTTGAATAACTTCATTTCACTCAACACTGTTTTTGTATAACTGAAAAGATGCCGTAGTAACTTAACCTTCATTTACATCAGTTAGCCTATGGTAAAACTGGTTCTTTTATACTTCATTTCCCTTAAAGGCACAGAACCAACTGACGATGTTAATTGAGGACTCACTGTATTACAGAACATCTTCGTAGTGTGGAACAAAATGTAGAAATGAGGGGAGTATTGCAGACAGATGTCTCCCTCGTTCCTTCTACCCTAGGCAAGAGTTTAGAGAACTCTTCTCTGGAGAGAGAATGGGTTCAGAGCAGAGACCCTGAGACACTAACATCTTGGGGCCCCCAGCAAAAGAGTTGACTTTCTACCTAGCGATCTGATGAAGCCACCTCTGTTAGAAAACTCCCACCTGTGTCCACAGGACTTCCAGTCTCATTCTTTTACATGAGGTAGTAACAATCACCAGACCAACACAAGCAATAGAGAACCAAAGGGAATGAGGAAAGAGAATGCAGGTGGCAGAAACTTTAAAACATAATTGGTTTTCTCAGGGAGATAATAGAATGTATCCTACATATAACACAAGTAGAGGACGCTAGAGAAAAGGAATATTCTAAGAACAAGAACCATTCTCGGAAACTAAAAACATGGTAACTAGAATATAAATTTAGGCGGGAAGGTTGGAAGCTAAAGCTAAAAAATTGCCCTAGAAAGTTAGATGGGAAATAGGAAAAAAATGAAAAAGAAATAAAAGAATTCTTTAAAAGTAATGTTTGAGTAAGCTTAAGTTGGTCCTGTTCAGGTATGTTTTTGGTCTATGTGTTGATTGTCCTTGTTCTAAAATTAGTAATAGAGAATAAATTTCTACAAAGCAAAATTAGAATAAAAAGAATAAATCATTAAACTCCTGTAACAAAGCTGTTTTCTCATCCTACCTGTTTCTTTCCTTTCATTTCATATCATTCAACATGTGATGCTTACGTATTTCCTTAAAAAATAACCTATTATTTTTCCCTTTGCACAGGTAATTTAGATTTTTAATTTATTTGGTTGTCATAGTAGCATAAATTAGTTCTGTTACTTAGACATACAAATAGTGACTAAGCCCGGTTGCATTTGTTTAGGGTTGTTGAACTCCTTTTATTTTTTTACTCCTTTTCGTGGGAACCCCGAATAATACTGAGATTTGCTCTAAATTAGAAAACTGGTTTACCAATTATTGCAGAATCCTGCTGTTGGGATTAGCAAGCAGTCTATCATTATGGCTTATTCTGTGCATACTCTTTCCTCAAAATTGCTGAAGGAAAGTTTTTAATTTTAACTGTTGTTGTTTTGCAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGCTTTAGCCAAGCATTAAATTAATTTTCAATTATATCCTTTGTTGTATTTTGCTGATTAGTTTTAGTCAAGAGCATTTCAAATCAGTTTAATATAGTGAGACTGGTAGTATGTGTATCCTGGTCAACTCAAATATTTAGAAGAGTGTCATGCATTCTAGTTGCTGTCAGTTTTTATTTTAGGACCACGGCTTATTGATTCTGAATGAATTTTTTGTTACACCTTAGTGGCCCACTAAAAATTTAGATGAGATCACTTATTTCCAACTTCAGAGGAATGAAACATTGAAACATGTACATATAGAACATGCACATCATTTGTGTGTTAAATTTGTATTTCCAAACCCATAGACTGATTTCTTATGTCTGCTTTTAAGGATGCTTGCAGTGAACTTTGGGACTTTTAATCTTATGAAATCCATTAGGCTGCTTTGGTTTCAGGAATGTGTTTGCACACTACAGCACAACTTTGATACAAAGCGAATTTAGCATAGACTTGTGCATAAGGCAAGTGATTCTCTTCGCAGCCAGAAAACTTTTATTTCTGAAATAGCTAAAGGACATCCTTTCTTATGAAGGGAATTGTGAAAAGATAAATTCAGAGGGTGACATTTTAATAAAGCTGAAGTTTTGTCTTCTAAA