Transcript asmbl_209413

Sequence
Transcript Sequence for observation asmbl_209413 of TGE0006507:
AGCGCATGCGTGCTCCGCGCGCGTGGTAGCGCGAGGGAAGACAGGACCCGGCGGGAGCTTGGGAGAGCGCGCGTGCGCCGTCGCGAGCTCGGCGCTGCCGGGCAGCCGTGTGGGAGCGGGTGTGAGACCGCCGTGCGGGCCGCGGGAATGTTCCGAAAGGCCCGGCGAGTGAACGTGCGCAAGCGGAATGACTCGGAGGAGGAGGAGCGAGAGCGCGATGAGGAGCAGGAGCCGCCGCCGTTGTTGCCGCCGCCCGGCACTGGAGAAGAGCCGGGCCCCGGCGGCAGCGACAGGGCCCCCGGGGGAGAGTCGCTACTGGGCCCCGGGCTGCCACCGCCTTCTGCACTGACCCCAGGGCCCGGGGCCGAGGCCGGGAGCTGCTTCCCGGGCGGCGCGGAACCTGGCAACGGGCTGAAGCAGCGCAAGAGGCCGCGCGAGAACAAAGAAGTGCCCCGGGCCAGCCTGCTCAGCTTCCAGGACGAGGAGGAAGAAAATGAAGAAGTTTTTAAAGTGAAGAAATCAAGTTATAGCAAAAAGATTGTAAAATTACTTAAGAAAGAATATAAAGAAGATCTTGAAAAATCAAAGATTAAGACAGATGTCAACTCATCAGCTGACAATGAACCACCTTTGGACAAAACAGGACATGTTAAGGACACCAGTCAAGAAGATGGAGTTATTATTAGTGAACATGGTGAAGATGAAATGGATATGGAAAGTGAGAAGGAAGAAGAAAAGCCCAAGGCTGGGGGAGCCTTTTCAAATGCTTTATCTTCTTTGAATGTTCTCCGTCCAGGAGAAATTCCAGATGCAGCTTTCATACATGCTGCAAGGAAAAAGCGTCAGATGGCCCGGGAATTGGGAGATTTCACTCCTCATGATAGTGAGCCTGGTAAAGGCCGCCTTGTTAGAGAAGATGAGAATGATGCCAGCGATGATGAAGATGATGATGAGAAACGCCGTATAGTATTTTCTGTGAAAGAAAAGTCTCAAAGACAAAAAATTGCCGAGGAAATAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGCTTTAGCCAAGCATTAAATTAATTTTCAATTATATCCTTTGTTGTATTTTGCTGATTAGTTTTAGTCAAGAGCATTTCAAATCAGTTTAATATAGTGAGACTGGTAGTATGTGTATCCTGGTCAACTCAAATATTTAGAAGAGTGTCATGCATTCTAGTTGCTGTCAGTTTTTATTTTAGGACCACGGCTTATTGATTCTGAATGAATTTTTTGTTACACCTTAGTGGCCCACTAAAAATTTAGATGAGATCACTTATTTCCAACTTCAGAGGAATGAAACATTGAAACATGTACATATAGAACATGCACATCATTTGTGTGTTAAATTTGTATTTCCAAACCCATAGACTGATTTCTTATGTCTGCTTTTAAGGATGCTTGCAGTGAACTTTGGGACTTTTAATCTTATGAAATCCATTAGGCTGCTTTGGTTTCAGGAATGTGTTTGCACACTACAGCACAACTTTGATACAAAGCGAATTTAGCATAGACTTGTGCATAAGGCAAGTGATTCTCTTCGCAGCCAGAAAACTTTTATTTCTGAAATAGCTAAAGGACATCCTTTCTTATGAAGGGAATTGTGAAAAGATAAATTCAGAGGGTGACATTTTAATAAAGCTGAAGTTTTGTCTTCTAAA