Transcript asmbl_204689

Sequence
Transcript Sequence for observation asmbl_204689 of TGE0006437:
GGTTTGCCTGCAATGAAAGTTCGTTCTCTACAGCTAAAGGACATCCTTTCTGAGCTGCTGTGAATAAATTTGGAATGATACTGTATATTTTCATCTAATGGAGAATTAGCTATACCTTGAAAAAGGATTGCTGCACTGGACAACTTCAGACTATTGCTCACAATGTCATCAAACAGGAGTCAGAATCCCCATGGACTGAAGCAGATTGGCCTTGACCAGATCTGGGACGACCTCAGAGCTGGAATCCAGCAGGTGTACACCAGACAGAGCATGGCGAAATCCAGATACATGGAACTCTACACTCACGTTTATAACTACTGCACGAGTGTTCACCAGTCAAACCAAGCGCGAGGGGCTGGCGTCCCTCCTTCTAAATCAAAAAAGGGGCAGACGCCTGGGGGAGCCCAGTTTGTTGGCTTGGAGTTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGACAAACCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAAGTTCTATACTCAACAGTGGGAAGATTACCGATTTTCAAGCAAAGTGCTGAACGGAATTTGTGCCTACCTCAATAGACACTGGGTTCGCCGTGAATGTGATGAAGGACGGAAAGGAATATATGAAATCTATTCTCTCGCGTTGGTGACTTGGAGAGATTGTCTGTTCAGGCCATTGAATAAACAGGTAACAAATGCTGTTTTAAAACTGATTGAAAAGGAAAGAAATGGTGAAACCATCAATACAAGACTGATTAGTGGAGTCGTACAGTCTTACGTGGAATTGGGGCTAAATGAAGATGATGCGTTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTCGAGTCTCAGTTTCTGGCTGACACAGAGAGATTTTATACCAGAGAGAGCACCGAATTCTTGCAGCAGAACCCGGTTACTGAATATATGAAAAAGGCAGAGGCCCGTCTGCTCGAGGAGCAGCGGAGAGTGCAGGTTTACCTTCACGAGAGCACCCAGGACGAGCTCGCACGGAAGTGTGAGCAAGTGCTCATTGAGAAGCACCTGGAAATTTTCCACACAGAGTTTCAGAACCTGTTGGATGCTGACAAAAATGAAGATCTGGGTCGCATGTATAATCTTGTGTCTAGAATCCAGGATGGCCTAGGAGAATTGAAGAAACTTTTGGAGACGCACATTCATAATCAGGGTCTTGCAGCAATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGTTGGACGTTCATAAAAAGTACAACGCCCTGGTCATGTCCGCGTTCAACAACGATGCGGGCTTTGTGGCCGCACTGGACAAGGCTTGCGGTCGCTTCATAAACAACAACGCAGTTACCAAAATGGCACAGTCGTCCAGTAAATCCCCTGAGCTGCTGGCCCGATACTGCGACTCCTTGTTGAAGAAGAGCTCCAAGAACCCAGAAGAAGCAGAACTAGAAGATACGCTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAGGATAAAGACGTGTTTCAGAAGTTCTACGCAAAAATGCTGGCCAAAAGACTGGTGCATCAGAACAGTGCAAGTGATGATGCCGAAGCAAGCATGATCTCTAAACTAAAGCAAGCCTGTGGCTTCGAGTACACCTCTAAGCTGCAGCGGATGTTCCAGGACATCGGCGTGAGCAAAGACCTGAACGAGCAGTTCAAAAAGCACCTGACGAATTCAGAGCCGCTAGACTTGGATTTCAGTATTCAGGTTCTGAGTTCCGGATCGTGGCCCTTTCAGCAATCCTGTACATTTGCCCTGCCGTCGGAGCTGGAACGTAGTTATCAGCGCTTCACAGCTTTTTATGCTAGCCGTCACAGTGGCCGAAAGTTGACATGGTTATATCAGCTGTCTAAAGGAGAATTGGTAACAAACTGCTTCAAAAACAGATACACTTTGCAGGCATCCACGTTCCAGATGGCGATCCTGCTGCAGTACAACACAGAAGACGCGTACGCCGTGCAGCAGTTGGCGGACAGCACTCAGATCAAAATGGACATTTTGGCACAAGTCCTACAGATTTTATTGAAGTCGAAGTTATTGGTCTTGGAAGATGAAAATGCAAACGTCGATGAGGTGGAACTGAAGCCAGACACCTTGATAAAATTGTATCTTGGTTATAAAAATAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACTGAACAGAAGCAGGAACAAGAAACCACACATAAAAATATTGAGGAAGATCGCAAACTCCTGATTCAGGCAGCTATTGTGAGAATTATGAAAATGAGGAAAGTTCTGAAACACCAGCAGTTACTTGGAGAAGTGCTCACGCAGCTGTCCTCGCGGTTCAAGCCTCGGGTCCCAGTAATTAAGAAATGCATTGACATTCTGATCGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCCAGAAGTGTCTGACTGTGCGACCCTCCACACATAGTTCCCGGTGGAAAGGATGAAAACTCGAGCTCATAGCAGCCAGTCTGCCGCCATTTGAACCTCCCTTTTTAAAACTGAGACCAAGACTCCCATCAGCCAGTCTCAGATGTACATCAGAACTGCTCAGGATTGATACATTTCAAGTCTGTAAATATAGACACCGACGCCATTTAACCTAATTTAAGAACAGAGGGGAACCGAACCCTCCACGCCGAGGGCTGCATGCTACTGCATTCAAATCGATACGCTGGCTCCGGGGCTCACAGCTGCCGCCTGAGGCAGCACTTACAGTGTTGGCAGCACTTTGAAAGCGAGTCTGAATGGACCCACGTGTAATCTGCTATGAAAACCCATTTGTATAGTGTGTTTCATTTTTTAATGTGTGAAAATAAAGAAAATTAAAGGATTTCTGTACAAGTTGCATTTGGTTTTGTTTTCAGTTTTACTAATTTCTATATGTAAATAAAAGATAATAATTGTGCAAATT