Transcript asmbl_204603

Sequence
Transcript Sequence for observation asmbl_204603 of TGE0006435:
TATATATATGTGTGTGTGTGTGTCGATATGTTTGAGAAGCTTTGGATAAAGATTGCATAGATCAATTTATGACGAGAGTGAAAGCGAAAATTTTAAAGGAGTGATTTATACCGTTTCACTTTCGGTTTGGAACATTAATGGATTTCTGCTTTTTAAGGAGGCGGCTGTAATGGGGAACATGAAACTTTCAGTTCTCCAGTTAAAAATCGAAAACTGCTTTTTTAAAACCTTTTTTCTTTTTGATTTGATTTAAAAACTGTATCCTCGCTTATTCTGCTGTCTATAACGGAAGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGTAAGTTATCGAACTTGATTTAAAAATCAGGTGAATTGGGTTTGGGGGAGTGTGGAATACAGGCCCGGAATAGAAAAAGGAAAGTTACTTACCTGGGTTACATTAACTCATATATTTCTTTTGCTTTCTAGAACTCATCTTTATCTTTCAGAACCTAATAACTTTTTACTCTTCTTCCTGCTTGTCTGATCTGGCTGCCCTGCCCCTTTCAGCTGTTTCGCGTCCCAGATAGCCTGGCCACCCCTTTGCACTGCTCTGCCGCTGAGGGCTGAGTAGCCAGCTCCATTGCAGCAGGTGCTTCTTTGGGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAGAAAATATATTCAAAAATTGTCAGCCTCATTTTGCAATCAGTTACTCCGACTCCTAAACTGTTATGGGTGTTGAAAATGCCTGTGTGGTCTAGAGCTTCATTTAGATTCGAGATGTTTGCTTCCACTGAGTTCTCTGCAGAAATCGAAACATCGATGTCTGTTATAAACAGATGAATAAAAAGCAGGCCGGGCTGATGGGGCAGCCCAAGTGAGGGGGGGAAGGGGGCGAGGAGAAATCCTGCCCAGGTGGTGAGGGGTCAGGTGGTGAGGGGTTTCTTGGCCTTGTTTGAGACCCTGTCAGACCGTGTCAGATTTGGGGCCTGAATTGCAGCTTTTGGCTGACAAGTTACTGTCCGGGGCTCGGGCTAGGTGTGGCCTCTATCTTCCCAAATGTTTTTTAGAATGATCGTGGCAGAACCTAGGGCAGCAGTCACACCAGTAGTCTCTGACTTCGCTCCATTTTCTTGTGAAGAGATGCAGAGTAGCCAGTGCTTGAGCTAGGGATGGTTCCAAGCGCGTGCTGTCCACCAGCAGGGCTGCCCACCTCCACGGGCTGGGAGACAAACTCTGGTCCTGGCTCTGCCTGAGTGTCACTCCCTGTTCTGGAGGGCAAGACAAGAAGCAAAGGACATTCGTAAACGGGGGAGCATGCTGCGGCCAGAAGTCATAGAGGAGATGGACATTGGGCTCCTTGGATGGAGGAGAAAAGAACGTTCTAGACCTGGGACAAATGAGGTAAGAGTGGAGGAAGGACAGGCCAAGCGTGCCATATTCTTGGGGTCACAGAAGCTGTTCTAGACCCACCAGAGGGTGTGTGTTGGGGGAAGAGAATGAGGTTGGAAGGATCGCTGAGTCCAACTACAGGGCACCCCGAAAGGCAGGCAGGGGTCTAGATTTGAGTGGCAGCATCCCGGGGCCAAGGGAGGACTCTGAGCACGTGTGGGCTGCAGATGTCTGTCACGTGGATGGGGTCACGCGGAGGCCCTGGGAGGCTGTGGCTGGAGCATGTTGCATGCAG