Transcript asmbl_204602

Sequence
Transcript Sequence for observation asmbl_204602 of TGE0006435:
GGAGTAGACTCTCTGGAATACACAACTCATCTTTATCTTTCAGAACCTAATAACTTTTTACTCTTCTTCCTGCTTGTCTGATCTGGCTGCCCTGCCCCTTTCAGCTGTTTCGCGTCCCAGATAGCCTGGCCACCCCTTTGCACTGCTCTGCCGCTGAGGGCTGAGTAGCCAGCTCCATTGCAGCAGGTGCTTCTTTGGGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAGAAAATATATTCAAAAATTGTCAGCCTCATTTTGCAATCAGTTACTCCGACTCCTAAACTGTTATGGGTGTTGAAAATGCCTGTGTGGTCTAGAGCTTCATTTAGATTCGAGATGTTTGCTTCCACTGAGTTCTCTGCAGAAATCGAAACATCGATGTCTGTTATAAACAGATGAATAAAAAGCAGGCCGGGCTGATGGGGCAGCCCAAGTGAGGGGGGGAAGGGGGCGAGGAGAAATCCTGCCCAGGTGGTGAGGGGTCAGGTGGTGAGGGGTTTCTTGGCCTTGTTTGAGACCCTGTCAGACCGTGTCAGATTTGGGGCCTGAATTGCAGCTTTTGGCTGACAAGTTACTGTCCGGGGCTCGGGCTAGGTGTGGCCTCTATCTTCCCAAATGTTTTTTAGAATGATCGTGGCAGAACCTAGGGCAGCAGTCACACCAGTAGTCTCTGACTTCGCTCCATTTTCTTGTGAAGAGATGCAGAGTAGCCAGTGCTTGAGCTAGGGATGGTTCCAAGCGCGTGCTGTCCACCAGCAGGGCTGCCCACCTCCACGGGCTGGGAGACAAACTCTGGTCCTGGCTCTGCCTGAGTGTCACTCCCTGTTCTGGAGGGCAAGACAAGAAGCAAAGGACATTCGTAAACGGGGGAGCATGCTGCGGCCAGAAGTCATAGAGGAGATGGACATTGGGCTCCTTGGATGGAGGAGAAAAGAACGTTCTAGACCTGGGACAAATGAGGTAAGAGTGGAGGAAGGACAGGCCAAGCGTGCCATATTCTTGGGGTCACAGAAGCTGTTCTAGACCCACCAGAGGGTGTGTGTTGGGGGAAGAGAATGAGGTTGGAAGGATCGCTGAGTCCAACTACAGGGCACCCCGAAAGGCAGGCAGGGGTCTAGATTTGAGTGGCAGCATCCCGGGGCCAAGGGAGGACTCTGAGCACGTGTGGGCTGCAGATGTCTGTCACGTGGATGGGGTCACGCGGAGGCCCTGGGAGGCTGTGGCTGGAGCATGTTGCATGCAG