Transcript asmbl_58350

Sequence
Transcript Sequence for observation asmbl_58350 of TGE0006472:
CTTCCTCCTGGTCAGATACTTCCACTTTCAGTTGTGAAAGAAAAACCAGGAAGTGAAGTCCCCGAGCACGTTAGGAAGCCCGGCCACGGCCTGACTCCGGACAGGGCGGACGGGGTGCTCTGAGCTGTGGCCATCTGCCCGCATGAATGTTCTGAAGCCATCCTGTCCCTGGAGAAAACAGGGGTGAGGAGGAAGAACAGGGACTCGTGTGCCAGGAAGAACTCGGAGCCAGGAAGCCCCATTTGCTGGAAACACCAAGAGATGTGGCCCCCCTCACAGGGCCTGAATTTCCTGCTGCTATTCACAAAGATGCTTTTTATCTTTAACTTCTTGTTTTCCCCACTTCCAACTCCGGCACTGATCTGCATCCTGACCATTGGAGCTGCCATCTTCCTATGGCTGATGAACAGACCTCAGCCAGTCTTGCCTGATATTGATCTGAACAACCAGTCAGTGGAAATTGAGGGAGGAGCACGGAGGAGCGCAAAACAGAAAGACGACGAACTGCTCTCTTACTACTTCTCAGATGTCAAGACAATATACGAAGCTTTCCAAAGAGGACTGGTTGTATCTGGCAATGGGCCTTGCTTGGGATATAGAAAACCAAATCAGGACTACAGATGGCTGTCCTACAAACAGGTGTCTCATCGAGCAGAGTACCTGGGCTCCTGTCTCTTGCATAAAGGATATAAGCCATCACCAGACCAATTTGTTGGCATCTTTGCTCAGAATAGGCCAGAGTGGATCATCTCGGAGTTAGCTTGTTACACGTACTCCATGGTGCCTGTCCCCCTGTATGATACCTTGGGAGTAGAAGCTGTCGTGTACACTATCAACAAGGCTGATATTGCCATGGTGATCTGTGATACACTCCAAAAGGCATTGGTCCTGATAGGAAATGTGGAGAAGGGCCTCATCTCAGGCCTAAAAATAATCATCCTCATGAATTCCTTTGAAGATGACCTGAAGCAAAGAGGGGAGAAAAGTGGAATAGAGATCTTATCCTTCTCTGAAGCTGAGAATATAGGCAGAGAGAACTTCAGAAAACCCGTGCCACCTACACCAGAAGATCTGAGCATCATCTGCTTCACCAGTGGAACCACAGGTGAGCCCAAAGGGGCCATGCTAACCCATCAAAATGTCATTTCAAATGCTGCTGCTTTTCTCAAACTTTTGGAGGACAGCTTCCAGCCCACTCCCAAGGATGTGACCATATCCTACCTCCCCTTGGCTCATATGTTTGAGAGGGTTGTACAGGTTATTATGTACTCTTGTGGAGCCAGAGTTGGGTTCTTCCAGGGAGATATTCGGTTGCTGCCCGATGACATGAAGACTCTGAAGCCCACGGTGTTTCCCATAGTGCCTCGACTCCTTAACAGGATCTACAATAAGGTTCAAAATGAAGCAAAGACACCCTTGAAGAAGTTCTTGTTGAACTTGGCTGTTGCCAGTAAAATCAATGAAATGAAAAAGGGTATCATCAGACGCAACAGTTTCTGGGACAAGCTCATCTTTGCAAAGATCCAGGACAGCCTGGGTGGGAAGGTCTCCTTAATGATCACTGGAGCTGCCCCCATCGCCTCTCCTATCTTGACATTCTTCCGGGCAGCAATGGGATGTATGGTGCTTGAAGCTTATGGACAAACGGAATGCACTGCGGGCTGTACATCTACGTTACCTGGAGACTGGACGTCAGGCCATGTTGGAGTCCCTGTACCTTGCAATCACGTGAAGCTGGAAGATGTGGCTGACATGAACTACTTTTCGGCAAACAACGAAGGAGAGATCTGCGTCAAGGGAAGCAGTGTGTTCAAAGGATACCTGAAGGACCCTGAGAAGACAAATGAAGCCCTGGACAAGGACAACTGGCTTCACACAGGAGACATTGGTCGCTGGCTCCCGAATGGAACTCTGAAGATCATTGATCGAAAAAAGCACATTTTCAAGCTGGCCCAAGGAGAATACATTGCTCCAGAGAAGATAGAAAATATCTACATCAGGAGTAAACCTGTGCTGCAAATTTTTGTACACGGGGAAAGCTTATGGTCATTCTTAATAGCAGTGGTGGTTCCTGACCCAGACGTACTTCCCTCATTTGCAGCCAAAATTGGGGTTAAGGGCTCTTTTGAAGAACTGTGCCAAAACCAAGTTGTAAAGGAAGCCGTTTTAGAAGACTTGCAGAAAATTGGGCAAGAAAATGGCCTTAAAACCTTTGAACAGGTCAAAGACATTTATCTTCATCCGGAGCCATTTTCCACTGAAAATGGGCTCTTGACACCAACACTGAAATCAAGGCGGGAACAGCTTGCCAAGCACTTTCAGACACAGATCAACAGCCTGTATAAGGACATCTAGGAGTAGGCTAAGGTACTGCTGGGAGGGGCTCAGTAGTATGTCTTGTGGGAATATGACTTAAAAACTAGTCTTATGTTCACTACTTGTCTTTCTGCCTGTCTATTGTTCTACCTACTAAATTATAAAACTATAGTTTGGGGGCTTTTTAAAAATAATATTAAGTGAGAAACTTATAATGTGG