Transcript asmbl_204257

Sequence
Transcript Sequence for observation asmbl_204257 of TGE0006368:
TGCCCGTTGGGCGCCCGCGCGTCACGTGGTGAGGAAGGAGGCGGAGGTCCCGGGCTTGGAGGAGGGAGATAGAGAAGAGGGAAGGAAAACGGGGAAGGGAGGAAGGAAACGAGCGAGGGGGAGGGAGGTCCCTGTTTTGGCGGAGCTGAGAGCGTTGCCGTCCTCTGAAGTGGAGCGAGAGGGAGGTGCTTTGCCGTTTCTCCTGCCGGGGGTCCCGGCTTCCCGTGGAGGCTCCGGATCAAACCCCTTCAGCTTCTCCCTCCGGATCGATGTGCTGCTGTTAACCCGTGAGGAGGCGGCGGCAGCGGAAGATGGTGTTGCTGAGAGTGTTAATTCTGCTCCTCTCCTGGGCGGCGGGGCTGGGAGGTCAGTATGGAAATCCTTTAACTAAATACATTAGACATTATGAAGGATTATCTTATGATGTGGATTCATTTCACCAAAAACACCAGCGTGCCAAAAGAGCAGTCTCACATGAGGACCAGTTTTTACGTCTAGATTTTCATGCTCATGGAAGACATTTCAACCTACGAATGAAGAGGGACACTTCCCTTTTTAGTGATGAATTTAAAGTAGAAACATCAAATACAGTACTTGATTATGATACCTCTCATATTTACACTGGACATATTTATGGTGAAGAAGGAAGTTTTAGCCATGGGTCTGTTATTGATGGAAGATTTGAAGGATTCATCCAGACTCATGGTGGCACATTTTATGTTGAGCCAGCAGAGAGATATATTAAAGACCGAAGTCTGCCTTTTCACTCTGTCATTTATCATGAAGATGATATAAACTATCCCCATAAATATGGTCCACAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGGATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGAAACATAAAGAAGAACATGCCGTTAATGGTCCAGAACTTTTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATCTGTTCTTTAAATATTATGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATCGATACAATTTATCAGACCACAGACTTCTCCGGAATCCGTAATATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTACTGATGAGAAGGACCCAACAAATCCTTTCCGTTTTCCAAATATCGGTGTGGAGAAGTTTCTGGAATTGAATTCTGAACAGAATCATGATGACTACTGTTTGGCCTATGTCTTCACCGACCGAGATTTTGATGATGGCGTTCTTGGTCTGGCTTGGGTTGGAGCACCTTCAGGAAGCTCTGGAGGAATATGTGAAAAAAGTAAGCTCTATTCAGATGGTAAGAAGAAGTCCTTAAACACTGGAATTATTACTGTGCAGAACTATGGGTCTCATGTACCCCCCAAAGTCTCTCACATTACTTTTGCTCATGAGGTTGGACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGCACTCCAGGAGAATCTAAGAATTTAGGGCAAAAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAATAAATTCTCACTCTGTAGTATAAGAAATATAAGCCAAGTTCTTGAGAAGAAGAGAAACAACTGCTTTGTTGAATCTGGCCAACCTATTTGTGGAAATGGAATGGTAGAGCAAGGTGAAGAATGTGATTGTGGCTATAGTGACCAGTGTAAAGATGAGTGCTGCTATGATGCGAATCAGCCAGAGGGGAAAAAATGCAAGCTGAAACCCGGAAAACAGTGCAGTCCAAGTCAAGGTCCCTGTTGTACAGCACAGTGTGCATTCAAGTCAAAAACTGAAAAGTGTCGGGATGATTCAGACTGTGCAAAGGAAGGAATATGTAATGGCATTACAGCTCTCTGCCCAGCATCTGACCCTAAACCAAATTTTACAGACTGTAATAGACATACACAAGTGTGCATTAATGGACAATGTGCAGGTTCTATCTGTGAAAAATATGGCTTGGAGGAGTGTACTTGTGCCAGTTCTGATGGCAAAGATGATAAGGAATTATGCCATGTCTGCTGTATGAAGAAGATGGACCTATCAACTTGTGCCAGTACAGGGTCTGTGCAGTGGAGCAAGCAATTCATGGGTCGAACCATCACACTACAACCTGGATCCCCGTGCAATGATTTTAGAGGCTACTGTGATGTTTTCATGCGTTGCAGATTAGTAGATGCTGATGGTCCTCTAGCTAGGCTTAAAAAAGCAATTTTTAGTCCAGAGCTCTATGAAAACATTGCTGAATGGATTGTGGTTAATTGGTGGGCAGTATTACTTATGGGAATTGCCCTGATCATGTTAATGGCTGGATTTATTAAGATATGCAGTGTTCATACTCCAAGTAGTAATCCAAAGTTGCCTCCTCCTAAACCTCTTCCAGGCACTTTAAAGAGGAGGAGACCGCCACAGCCCATTCAGCAACCCCAGCGTCAGAGGCCCCGGGAGAGTTATCAAATGGGACACATGAGACGTTAACTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGACACCTATTAAATCATCCCCAAACTAAACCCTTACAACTAACAGAAGAAAAAAAAAATGGCAAGAGATCATGTCCTCAGACCAGGTGGAATTAATTAAATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGGGGTGGAAAGGAACCCAGTTTTCTTATGGACAGATATTTTTAACCTAATGGCACAAAGTCTTAGGATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGGCAAACTTGGCTCTGGATAAACTTTTATCACAAATTGAAATATATATATATTTTTTTCAACTGCCAGTCAAGGCTAGGAGGCTCAACCACCTCAGCATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTGTACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTCCTTTGTATTATAAAATTTTTCTGCTCTTAATGAAAAATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACAGGCAGTTTTGAAATGAGAATCAATTTACCTTTTTCTTATGATGGAATTGGTTCTGATATTCATTTTGTCTTTATCAAATGGCTGCTAAGAGCACATGAGTGACTTCGCTGAAGAACACAAGTGTTGTGCAAACTGGACATATGCAGCATACTACTTCAGAGTTAGTTCTTTATGTAAGTGTCTGATTTCTGCTTACTTGTTTTAGACTTTCTAACTCAATTCCAGTTTTGAATTGATAGGTAAAATTTTATTCATGCTTTGGTAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAACCTCTTATTTGTTTTTTCCATATATCTAAAGTATGCTAATTATGTTTTTGGTTTTTGTGTGATATGGAAAAGAAAAGCTGTGTCTTTATTTTATCAAAATATTTGAACATTTTTTTCAGCATATCATCACTGATCATTGTTAACCACTAAAGAGTGATTTGCTCTACTTGTAGTTAAAATTGTAGGATAGGCCTTCTGACCTTTTTTCCCCTGAAATATTTTAACAACAATGGAGTTGAAACAGCACAATGTCCCATTCCAAATTTATTTTGTAAACAGATGTAAATAATTGGCTTTTTAAAGAAAGAAAGCAAAAGCATTTAATGTATTAACAGGCTTATTGCTATGCAGGAATGGAAGGGGGCATTACAAGAAAATTTTAAGCTTGTGACATATTTATTACTTGTTTTCCAGCTACATCACTTAAATGAGATGTAAACAGCTATGATTTTCCTGGCTTCACATAGGAGGCAAATTTAGGGAAAGTTGAAAAAAAGTCTGTGTTTTGGCTTCTTTTTTTCCTTTTTTTTCTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAATGCTAGAGAAAATAATGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTTCAGAATACAGCTTTTTGTACATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTATGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGATTTGCATTTCTAAAATGGTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTACATTTTTTGCTTGTAATGTTATCCTGTGGTAGGGTTTTGGCAGGTACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAGAGATACGTGCACTGAACTCTCCACGGCAAATCAAGATGTGGTAAAACAAAAGGATCAAGACAAATGAGATCTAATACTACTGTCAGTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAAAAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACTTGATGAAATCAACTTGAAGGTTCCATACTCTTTGAACTCTGAGAACTACCAAAAGAAAAAAGCTCCCACAAGCAGTTTTTCCTTACAACGAAAGAGATTGTTAAACAAAAAGACAATTATCTCTTCCCGTGCAAATACAGATATCTATTCTTAGTTAAAAGACCATGTAAAAAATTTAGATATCTCAGGTATCTACACTCAAGAACGTTTTAAAAACACTTAACTGATCTCAACTGCTTTACATTATTTCCAGTCACTATTCAATGTGTTTAAAGGTGTTTGTCTTAGTGGAAGAGCTGAATAATTTTGGAAACTGGTATTATTTACAGTAAGTCTTCCCTTAACGTGGTCTGTAGGTTTCTGTGACTTGAAACCAATTTTACCATAGGCTCAATGGTATAGACAAAAGTTAAGTTCCTACAGCATCTCATC