Transcript asmbl_203713

Sequence
Transcript Sequence for observation asmbl_203713 of TGE0006406:
GTAAAGTCCCTTTTCTAACCTGGTGCAGCATCGTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATATGCTAGTATGCTTTATGTACACAAATTGAGAAGATATATTGATGTTAACATAAATACCTTTATAATTCTACTTTGGGCTCTATGTCTTCATATTTGATGCATGTGGGTAGGTAGCTGTAGCAGGTTGCTAGAAGTTTAGAGGTGGGAAGGAGGGAATTCTCATGTTCAATATCATCATCTTGGTCTAATCTGAACTCTTTAGTATTCTGCATACAAAATTGGATAAGATCATTGTGCATGTTTAGAGTTAAGCTCCAGTTTGCATACTTTGCTTAGAATTTTTGGAAATAGTTTTTAAAAGAAAATTGTCAATTATTGGAAAATCATTATAGTGGATTGAAAGAATTTTCATATAAAATTCACATTTACCTCATATTTGTGTGGCACATATGTTGCAGGCGAGAATTCTGTCAGAGAACCACCAGTACGCCAGTTGTATTGCACATATTTTGATATTTTTGCTTCACTGATTAAAATAATGGTAAACTTG