Transcript asmbl_203682

Sequence
Transcript Sequence for observation asmbl_203682 of TGE0006402:
TGGGGGTTGGTGTCGTCCGGAAGAAAGGACTCCTGCTGCAGATGTCTTGTGATTACCTCGGAAGCCTTACTTCGCCAGTTGAAACTGCAGAAGAAAATAGGATCTAGCGAAATATGGCTACGGAGGGCCCTGCCACGTGTCGAATCCAGGTGGCAGAACATCCCAGATTGCTAAAGCTAAAAGAGACATTTAACTCTAAGTTTGGATCCATTCCCAAGTTTTATGTTCGAGCACCAGGAAGAGTCAACATAATAGGAGAACATATAGATTACTGTGGATATTCTGTTCTTCCTATGGCTGTGGAACAAGATATGTTAATAGCTGTGGAACCTGTGAAAACACACACTCTTCAACTGGCCAATACAAATCCCTTGTACCCAGATTTCAGTACTAGTGCTAATAACATTCAGATTGACAAAACCAAGCCTCTGTGGCACAACTATTTCCTATGTGGATTTAAAGGAATTCAGGAACACTTTGGTCTTAGTAACCTGACTGGAATGAATTGCTTGGTGGATGGAACCATCCCACCAAGTTCTGGCCTCTCCAGCTCCAGTGCTTTGGTCTGTTGTGCTGGCTTGGTGACGCTCACAGTTTTGGGAATGAACCTATCCAAGGTGGAACTTGCAGAAATCTGCGCCAAGAGTGAGCGTTATATTGGCACCGAAGGAGGAGGGATGGACCAGTCCATATCATTTCTTGCAGAAGAAGGAACGGCCAAGTTGATAGAATTTAGTCCTCTGAGGGCAACGGATGTGAAACTCCCAAGTGAAGCAGTGTTTGTGATTGCCAACAGTTGTGTGGAAATGAATAAGGCAGCAACTTCCCATTTCAACATCAGGGTGATGGAGTGCCGGCTGGCTGCAAAGCTCCTGGCTAAGTACAAAAGCTTGCAATGGGATAAAGTACTGCGGCTGGAGGAGGTACAGGCCAAACTAGGGGTCAGCCTGGAAGAAATGCTGTTAATCACAGAGGATGCTCTTCACCCTGAACCCTATAGCCCCGAAGAGGTCTGCAAGTGTCTGGGAATTAGCCTGCAGGAACTCCGGACCCAAATCCTGAGTCCGAACACACAAGATGTGCTCATCTTCAAACTCTACCAGCGGGCAAAGCACGTGTACAGTGAGGCTGCGCGAGTACTCCAATTTAAGAGGATATGTGAAGAGGCACCTGGCAACATGGTCCAGCTGCTGGGGGAGCTAATGAACCAGAGCCATGTGAGCTGCCGGGACATGTACGAGTGTAGCTGCCCTGAGCTGGACCAGCTG