Transcript asmbl_203521

Sequence
Transcript Sequence for observation asmbl_203521 of TGE0006434:
ATTCGAGGGCGGCCGTCTTTCCTAGGCCACGATTGGTGGAGGCTGCCGTCATTTCGGAGCGCCCAGGCGCCTGGCCGCCCTCTCGCCGCGTCGCCGGTCCCTGAGCCGCCCGCACCTCCTCGCCTCTCCTCTCCCGGCCGAAGCCCGGGGGACCAGAGCGAGAAGCGGGGACTATGTTCCGACGCAAGCTGACGGCCCTCGACTACCACAACCCTGCCGGCTTCAACTATAAAGATGAAACAGAATTTAGAAACTTTATTGTTTGGCTTGAAGACCAGAAAATCAGACACTACAAGATTGAAGACAGAGGTAATTTAAGAAACATCCACAGCAGTGACTGGCCCAAGTTCTTTGAAAAGTATCTCAGAGATGTTAATTGTCCTTTCAAGATTCAAGATCGACAAGAAGCAATTGACTGGCTTCTTGGTTTAGCTGTTAGACTTGAATATGGAGATAATGCTGAAAAATATAAGGACTTGGTACCTGATAATACTAAAAATGCTGACAAAGCAGCTAAAAATGCAGAGCCACTGATCAATTTGGATGTAAATAATCCTGATTTTAAGGCTGGTGTCATGGCTTTGGCTAACCTTCTTCAGATTCAGCGTCATGATGATTACCTGGTGATGCTTAAGGCAATTCGCATTTTGGTCCAGGAGCGCCTGACACAGGATGCAGTTGCTAAAGCAAATCAAACAAAAGAGGGCTTGCCTGTTGCTTTAGACAAGCATATTCTTGGTTTTGACACAGGAGATGCAGTTCTTAATGAAGCTGCTCAAATTCTGCGATTGCTGCACATAGAAGAGCTCAGAGAGCTACAGACAAAAATTAATGAAGCCATAGTAGCTGTTCAGGCAATTATTGCTGATCCAAAGACAGACCACAGACTGGGGAAAGTTGGAAGATGAACATTTTAGGATGTTAGCCGCTCACCTACTTAGTACAGTTGGGAACCATGTATGCTGTGGCATGTGTTTGGGAATCAAATGTCAATTTTCAAGGAAAGGATCCCAGAAAATTGACTATGTTCTAGAGATTTATCATCATTGCTTTTTCTTTAATAAAGTTCAGGAATGTAGATTTTTTTTGACTGTGTAATATTTATGTATAATTCATCTTTTTCCTTTGTGATTAAGGTACATGCCAACCCCCAACTTTGTTTAAGAAACAATATAGATCCTCAGAAGTCATAGGAAAACTTAAAATATTTT