Transcript asmbl_203497

Sequence
Transcript Sequence for observation asmbl_203497 of TGE0006374:
GGTTTTATAGGATCACATTAACAAAAACATGATGGAGTTTTATGAGTCAACATATTTTATTGTCCTTATTCCTTCAGTAGTGATTACAGTAATTTTCCTCTTCTTCTGGCTTTTCATGAAAGAAACATTATATGATGAGGTTCTTGCAAAACAGAAAAGAGAACAAAAGCTTATTCCTACCAAAACAGATAAAAAGAAGGCAGAAAAGAAAAAGAATAAAAAGAAAGAAATCCAGAATGGTAACCTCCATGAATCTGATTCTGAGAATGTACCCCGGGAATTTAAATTATCTGATGCATTGGCTGTAGAAGATGAGCAAGTTGTACCTGTTCCACTGAATGTGGTTGATACTTCAAGTAGTGTTAGAGAAAGAAAGAAGAAGGAAAAGAAACACAAGCCTGTACTAGAAGAGCAGGTCACCAAAGAAAGTGATGTATCAAAGATTCCAGGCAAAAAAGTAGAACCTGTCCCAGTTACTAAACAGCCTACCCCGCCGTCAGAAGCAGCTGCCTCAAAGAAGAAACCAGGGCAGAAGAAGTCTAAAAATGGAAACGATGATCAGGATAAAAAGGTGGAAACTCTTATGGCACCTTCAAGAAAGCAAGAATCATTACCCCTCCACCAAGAGACTAAACAAGAAAGTGGATCAGGAAAGAAGAAAGTTTCATCAAAGAAGCAAAAGACAGAAAATGTCTTGGTAGACGAACCCCTTATTCATGCAACTACTTACATTCCTTTGATGGATAATGCTGACTCAAATCCCGTGGTGGATAAGAGAGAGGTTATTGATCTAATTAAATCTGACCAAGTAGAAGCAATTCAGAAAACAGGGGCTAAAAAACTGAAGACTGAAACTGACAAAGAAAATGCTGAGGTGAAATTTAAAGATTTTCTTCTGTCCTTGAAGACTATGATGTTTTCTGAAGATGAGGCCCTTTGTGTTGTAGACCTGCTAAAAGAGAAGTCTGGTGTGATACAGGATGCTTTAAAGAAGTCAAGTAAAGGAGAATTGACTGCACTTTTACATCAGCTTCAAGAAAAAGACAAATTACTTGCTGCTCTGAAGGAAGACGGCACTGCTATGAAGGATCGGTGTAAGCAGCTAACCCAGGAAATGATGACAGAGAAAGAAAGAAGCAATGTGGTTATAGCAAGGATGAAAGATCGGATTGGTGCATTAGAAAAGGAACATAATGTATTTCAAAACAAAATTCATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTTCCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAAGAAAATGGCATACTGAGAGATGCTGTCAGCAACACTACAAACCAACTAGAAAACAAGCAGTCTGCTGAACTAAATAAACTGCGCCAGGATTATGCCAGATTGGTGAATGAGCTGACTGAGAAAACAGGAAAGCTACAGCAAGAGGAAGTCCAAAAGAAGAATGCTGAGCAAGCAGTTACTCAGTTGAAGGTTCAACTACAAGAAGCTGAGAGAAGGTGGGAAGAAGTCCAGAGCTATATCAGGAAGAGGACAGCAGAGCATGAGGCAGCACAGCAAGATTTACAGAGTAAATTTGTGGCCAAAGAAAATGAAGTACAGAGTCTGCATAGTAAGCTTACAGATACCTTGGTATCAAAACAACAGTTGGAACAAAGACTAATGCAGTTAATGGAATCGGAGCAAAAAAGGGTGAACAAAGAAGAGTCTCTACAAATGCAACTTCAGGATATTTTGGAGCAGAATGAGGCTTTGAAAGCTCAAATTCAGCAATTCCATTCCCAGATTGCAGCTCAGACCTCTGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGATAAGCAGATAAAACAGACTGAAGATTCTTTAGCAAATGAACATGATCATTTAACAAGTAAAGAGGAGGAACTTAAGGATATACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAAAAATTACAGGCCCTGGCAAATGAACAGGCTGCTGCTGTACATGAACTGGAGAAGATGCAAAAAAGTATTCATGTTAAGGATGATAAAATAAGATTGCTTGAAGAGCAGCTACAGTGTGAAATTTCAGACAAAATGGAAGAATTTAAGATTCTAAATGACCAAAACAAAGCATTACAATTAGAAGTTCAGAAGCTACAGACTCTTATTTCTGAACAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTGAAGACTGTGGAAGAATTGCTTGAAACTGGGCTTATTCAGGTGGCCACTAAAGAAGAAGAACTGAATGCAATAAGAACAGAAAATTCATCTCTGACGAAAGAAGTTCAAGACTTAAAGGCTAAGCAGAATGATCAGGTTTCTTTTGCATCTCTAGTTGAAGAACTTAAGAAAGTGATCCATGAAAAAGATGGAAAGATCAAGTCTGTGGAAGAGCTTCTGGAAGCTGAACTTCTCAAAGTTGCTAATAAGGAGAAGACTATTCAGGATTTGAAACAGGAAATAGAGGCTCTAAAAGAAGAAATAGGAAATATCCAGCTTGAAAAGGCTCAACAGTTATCTATCACTTCTCAAGTTCAGGAGCTTCAGAACTTGTTAAAAGGAAAGGAGGAACAGATAAATACCATGAAGACTGCTTTAGAAGAGAAGGAGAAAGATCTAACTAATAGAGGGAAATGGTTACAGGATCTTCAAGAAGAAAATGAATCTTTAAAAGATCATGTTCAGGAGATAGCACAACATAACTTGAAAGAGGCATGTTCTGCATCACGATTTGAAGAACTTGAGACTGTGTTGAAAGAAAAGGAAAATGAAATGAAGAGAGTAGAAACTATGCTGAAGGAGAGGGAGAGTGATCTTTCTAGCAAAACAAAGCAGTTACAGGAGGTACAAGATGAAAACAGATTGTTTAAATCCCAAATCGAGCAGCTTAAGCAACAGAACTACCAACAGGCATCTTCTTTTTCCCCTCATGAAGAACTATTGAAAGTAATTTCAGAAAGAGAGAAGGAAATAACTTGTCTCCAGAATGAGTTAGATTCTTTGAAGGATGCGGTTGAACACCAGAGGAAGAAAAATAATGACCTTCGGGAGAAAAACTGGGAAGCAATGGAAGCATTGGCATCAACTGAAAAAATGCTGCAGGAGAGAGTGAACAAGACTTCCAAGGAAAGACAACAACATGTGGAAACTGTTGAGTTGGAGGCTAAGGAAGTTCTCAAAAAATTATTTCCAAAGGTGTCTGTCCCTTCTAATTTGAGTTACAGCGAATGGTTACGTGGATTTGAAAAGAAGGCAAAAGAATGTGTGACTGAAACTTCAGGTTCAGAGGAGGTTAAGGTTCTAGAGCACAAATTAAAAGAAGCTGATGAAATGCACACATTGTTACAGCTGGAGTGTGAAAAATATAAGTCCGTCCTTGCAGAAACAGAAGGAATTTTACAGAAGCTACAGAGAAGTGTGGAACAAGAAGAAAATAAATGGAAAGTTAAGGTCGATGAATCACAAAAGACTATTAAACAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGCTGAAAGATCTGTTGACTGAATTGCAGAAAAAACTTGATGATTCATATTCTGAAGCAGTAAGACAGAATGAAGAGCTAAATTTGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTGTAATGGCGTCAGCAAATAAAGGGATGCTTATTATTCA