Transcript asmbl_203479

Sequence
Transcript Sequence for observation asmbl_203479 of TGE0006369:
TTTCCCAAACTCCACCTCCACTGTATCTGCCTATGAGCGTCGCCCGCCACGTTCCTCTCCTCCTTCTCCCACAATCCTCTGTTCACCGGGCTAAAGACTGGGAAACGAGCTACAGAGAAGGCTATTGGTTGAAAGAGCAGCCAATGAGAGAGCCTATTACTAGTTTGCGTGCTGTGGTGTAGGGGGTGCGCTTAAGGCCCTGAAGCGCTACGCGTTCTGCTGGTTTTATCAGCATGAGCTCAATCGGTACCGGGTATGACCTGTCAGCTTCCACATTCTCTCCTGATGGAAGAGTTTTTCAAGTTGAGTATGCGATGAAAGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGTAAAGACGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAACGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGCTGGCAGATGCTCGTTCTTTAGCTGACATTGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTATAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTACATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGATCTTACAGTGTGAATGACGGTGCACAACTCTACATGATTGACCCATCAGGTGTTTCATATGGTTATTGGGGCTGTGCTATCGGCAAAGCCAGGCAAGCTGCAAAGACAGAAATAGAAAAGCTTCAGATGAAAGAAATGACCTGCCGTGATGTTGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTTGAACTAGAGCTCAGCTGGGTTGGAGAAATAACTAAAGGAAGACATGAAATTGTTCCAAAAGATATAAGGGAAGAAGCTGAAAAATACGCTAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAACACTTCTGCAGCTGTTTTAAATTTCTATTATAGTTCCCATGTAACTATTTAGCCCTGTGGATTATTACATACCTACTGACCAATTTTCATTAAAATTTTGTCTTGTAATGACTTAAGTTTGGTTACTATCTGCTTGACAAAATTGGTGGAGGTAATTAAGCACATATTTACTCAGCATTAAAATGTTGATGCCTATTTAAAAATTCCTTAGTTAAAATACTGCAAACCAGAGGCTTTGGAATCAAATTCAAAGCTCCATTCCATCATTCAGCTAGAATCTAAAGATTTTATGCTGGGATGTTGGGTAAAAAGTACCTACCAAACTTAGGAGGCAATTGACACTACTGCACAGTATTTATTGAAGTGATTTTGGTCATTGGCCACTGTTAACCTTTAGGTGTAACACAAGAAACATGTTTCAGGTTGGAAAGTCAAGAATATTTTATTGTGGTGAGGAGTGGATTTAAGTATCCATAAAGTTGCTATTCCATCAATTAAAACATTTCTGGATCTGTAAAGTTCAAATAAAAACACCCATATTTTATGCTAAATGATAAGTGAGACTACATGGAAGTGCTCTGTAAACAGAATGGTTACTGAGGAATAATCAGTATTGTTGCCTGCAAGAATTGTCATAACCAGAACAGTAGCACTCAGCAAGAAAAAAAAACAATTTGAACTCAAGCCAAGTATACCACATATATACACCATTTATTGGGCTCATGACAGTATTACACCATTCAGTTATGTTTTCTTAAGAAGGTAATCTAGGCACTGAGTTTTTAGCAGCAAGGGCATTGCTGAACTTTGAGCATCTGTGTAGTTCAAAGAGCAAATCTTTTACATGAACAGCTAACTACAAACAACTCAAGAACAACTCATACCCTGGCTTTTTTAATGTAAAATTACCTGTTACATTTTACAACTCATACATTTAACAACTCATACATTTAACTAAGAAAAGATTTGAGTACCTTGCTTACTGTAAACCTTGATACTGGTACCTAAAAAAGAAAAAAAAAATGTTTTAACCCATTTCCTGTTTAGAAAAAAAGTGCAGCTCACTGCCAGCATTAATTTTACATAAACTCTTTGAGGCCAAAGAAAATCTAAGTGGTTTTCAATGTGAAAATAAAATATAACTGTTCTTGGAGTTATTTCTGCACAGAACTTGTCTCTAATCCTAATGTAAAAAATGTATATGATGATCAGTATTTAATAATATTTTTCCGTGTGGTAAATTTCAAAACAAGGAACAACACAAAGCGGAACATCACATTTCTCACAAAAATACCGCGTTTCTCTCCGGATCTTCTTGCCATCCTTGTTGTGCGAGCAGCAAACTTTGCAGCGACCAGTTGGATTCTGTTTCCCTGATGTTGGTGGTATGCTCTTGGGGAAATGTCTTCCAGACAGGCGAAGTGGTGTGACATCATCAGAGCATGGGCGACCTCGAAGATGTTGCTGCCCTGGCTTGTGATGCTTTTCCAGCAGTCTTTCAATCAACGTCAGTCTGAAGTTTACATGACTGATTGTGTGTTCGGGATTGTCCTTCTTGAACAGGATGTAGGAGTTGAGCACTGTAATGTTTAGAAGGTGGCGAAAGAATTTTTTATACCAAAACTTGTGCCTTTTGCACTCAGTAGGATAAGAAGCAAGCATCTGATCAGCCAAGTCTACTGCTCCCATATTCTTGTTATAATCCACAATGACACAAGGCTTCTTAG