Transcript asmbl_198654

Sequence
Transcript Sequence for observation asmbl_198654 of TGE0006300:
GTGGGGCCAGGTCTCTCCACCGCGGGTCCTGTCGTCCTGCCCCATCGGGCATTTCAGCCAGCGGAACTGGAGGGGCAGTTGCCAGACGCGGTTCTGTAGAGCCAGGTCCAGCTGCTGAGCGGGTCTGAGGCAGGGGGCACTCCGCCAGGGCCGCCCCGGGGTGGCTGACGGCGTCTGGGGGCGTTCCTAGGGGCCGAGGAGGTCAGACCCGAAGCCCCGGGAGGAGCCGGCAGGCGGCCACGTGACCGACCGCGACGGGGCCGGCGGCCCAGAAATAGCAGCGGCGGCGGTTCCGCCCGCGGGCGCCGGGAGGGAAAGGCGGAGACTGGGGAACGCTGGCTCGGCGCGGGCGCGGCCCCGGCCCCGGAGGATGCTGAGCCCCTGCCCGGACCGTCCCGGAGCACATGATGGCGATACGGGAGCTCAAAGTGTGCCTTCTCGGGGACACCGGAGTTGGGAAATCGAGCATTGTGTGCCGGTTTGTCCAGGATCACTTTGACCACAACATCAGCCCGACCATTGGGGCGTCTTTTATGACCAAAACTGTGCCTTGTGGAAATGAACTTCATAAATTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCACTCCCTGGCTCCCATGTACTATCGTGGATCTGCTGCAGCTGTCATAGTGTACGACATTACCAAACAGGACTCATTCCACACCTTGAAGAAATGGGTGAAAGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCTATTGCTGGGAACAAATGTGATCTCTCAGATATAAGGGAGGTTCCCTTGAAGGATGCAAAGGAATATGCTGAATCCATAGGTGCCATTGTGGTTGAAACAAGTGCAAAAAATGCTATTAATATCGAAGAGCTCTTTCAAGGAATCAGTCGCCAGATCCCACCCTTGGACCCCCATGAAAATGGAAACAATGGAGCAATGAAGCTTGGGAAGCAAGCTACGCAAGCCAGCCGGCGGTGCTGCTGACCAGGGGTCACGGCCCACTGTACTTGAAGAAGCCAGAGTCACCTCCCCATGCACTGCTGAAGGACCCCCTAATCTTAGTGGCCTGGCGCCTCACTTAGAGAGAAGTGAGCACACTGGCTTGGCATCATGGAAGACCCACAGGGAACGGGGCAGGAAAAGTCCCCGGAAAAGGATTTGAGAAAACTCTGGAAAAATTCACCACGTCGCCTTTTGTGCATGAAATGCACACGGGAGGGAATGGATGTTAGGTAATAAGTATAGTTGAGTTTTTGTTAAACCTTAGAATATTCTCGATTTGTACAAAAATTTTACTGGTTTATTATGTGTGTGAGATTATAAAGTGGTGTTCCACTCTGATTTCCTGTGTTCCCTAGCCAAACTCCAGTAACTTCTTCAGCGCCATTGCTTCTGTTGACTAACCAGCCTTCACTGAAAGGTTAATTTAATTTTATTTAGTTTGCCTTTCACTGGAGCATAATTGGATCATCACTCAAGCTGTGGACTTGAGCTTTTATAAAAGTGGAGAAAGATGTATTAGAAACTGTTGTCAATATCTCCGACTCTTACTTGATGAACATTTTTCCAAGTTTTGATCATTATAAACAAACAAGCCCAATCTGGCTAAAAATATTGCATTTAATTTTGGGAGTGGGAGGCCTAATTTGGAAGAGTCGTTTAAAGTCACTGTATAAGCGGTGACAGATGTAGGACGTAAATATTATTCCAGAGACCATTTGGTATGCATCACCTCCACAGCAATAAATCCCTACTCTCTTAGAGAGGTTTTAATGCACAGAGTATTATTTTACTAAGAATTTGTGATAGTGTCACGTCTAAGGGGGAAATTAACTGGAGGACATTTAAGTCTATATCATAGGGCAAACTTCTAATAGCAGTTAATAACAGGTTACTGCAAAGCCAGCCAAGGGAAGTCCCAGCACCTTAAGATTCTAGACCTCTAACAGCACAATCAGAGAAAGCATTTGAGGAGATGCCAAGCCTGGGGAGGCAGATCTTAGGGCTAATGAGGACTCCAACTTTGGGATGCCAATTAACTGGGACTAGGCTGTGATAAAACCTTCCTTTTCAGGTACCCTGTCTGCTCAATTAATTAAAGATGTCTGACTGCAAAGGCAGTAAAGGGAGAAAAGGCATGAAGAGGAAGAAAAACTATTTCTATTCTAAATTCAAATCCTATTACCATTTTAATTTTCATAAAAACCTGGAAATCAAGAAGCAGTATGAGTGTGTGTGTGTGTGGGGTCCTATTAGGTCTTATATCGGGAGGTGATTCTTAAGATTTGGAATCGTGCCTTTTGTTGGGGTTAAGGAACTGTGACAGAATGGCCTCAGAAATGGTTAATTGTGCAGCATGGTCCAGCCGGTACCTTCTTTGCCATAAATGTTCAGGGGCTGAGAAACATTTATTGAAAATTTACAGTGTTAAAACCAGCAGAGAGATCATCAGCTGATTAAAGACCTCAAACTTTGAGTAACTCATGTGAGCTGGTGCTTCATGTCTTGCCACGACTGTGCCCTCTTTGCTCTTCACATATAGTGACACCGAGTCCCAACAAAAAGAAAGAGTCCTTGAGAGACCAGGGCCAAGTTTACACTTCTCTACATGGACAGTAATCAAGAAAATAGATGGAAATCACAGATTAAGGTGTTTTTGTTTGTTGTTGTTGTTTTAACAAAAGAATACGGTGTCAATTTGATTTTCTTACTTACTGCTTTGCTCAGCTTGCAAGAGTAGTTTGACAACCTTAAAATTTGAAGGCTGGAAACACTTATATTTGGTTCAAGAGTGCCTCTGAGCTCTCCCAGACAAGTACCTCAAAAAATGTTAGCAAGTGGCATTTGGATGTCTTGGTAGAGCTTTTACAGGGGTTTTTAGGGTTATCTCCACATTGTTAACATTACTTGCTAACATGATTCTGCTTGCAGGCCAAGCAATTATCATGCCTCTACAAAGCTCAAAAATTTGGGATGAAAATTGAAATGACATTTTCCAGGTGACATGCAGGCTTATTTTGGAAGCTTTCCTCATCAAGCTGTCCCTGAGAACCTGGGTTTCTCTCTAGACAGCCTCTCAGGTTTCCTAGATAAGGTGGTATGCGTCCCAGTGGAGTTACACAGCTTTAGGCTGGATCTCTAGTGGTTCTGTCTTGTATAAAATGGCTGGTCTTATAAACATGTAGAGAACTACCCACGAATGAGCCCATGGTTTTATTTCAGAAGCACATGAGGGTGTGAAACCACTCTTTTACCTTTCTGTATTGCTTTAACTATTCAAGCCAGTCAGATGACAGTGTATATAATTATTACTACTTGGAGCAACTGGTGAAAAGAGTAGATGGAACTTGGGCACACAAGCCTTCACTTAAACATGGGGTCTTCTCTGAAGACAGATGCTTCAGCCTTGTCCAGGCTTTCTTATCTTTCTTTATTCTGCCTTGAGATTACTTTCTGTTTGTTCTAACAATTGAAGTATAACCAAGTAATACTATGTAATGGCCTGGATATTACTTTTGCTCCAAAATGTCAAGTTGTTTCATGTGATGTAGCATCCTTCACATAATTTCACCAAATTTGCTCCTTTCCCTCTGTTTTCCCCCCCTTTCATGTGCAGTATATGTATATGTGTAAATATGATTTCATATTTGTTATGCCAACATATAATCCGTTTCACTGGCTAAGTTTGGCTCATGACCGTGTGTTATATAATATAGACATGGGTTCTTATTGGGATTATTTCCCAGTGGAAAGCCCTAAGATGGCAGTGGAGTCAGACATTTTATGTAGGTACATAATTGACTTGCCATTTTATAATTGAAAATGGTACACTAGTGTGTTGAATGTGATATTACCTTGTAGCCTATAGAAGATCGAAGACTTAAAACTAACCTTTAGCCAACAAAGAGCTGTGCCCCAATGAAATTTGAATTAATTTTCTGAAGGAGGTTTGGACGACTGAAATATTTCCTCTTAAGATAAAAGAATATGGCATGTGATGGCTACATTGAGCTCCTTTTAGGGGACTCCACTTCTCATTGCTCTGCAATGCTTGTAGTGAGTTGAATAATGAGCTGGCTTATGAAAGAAAGGACTCTGAGCTGTATTCAGACCTGTTAGGTATCGAGTTTACTCTTTTAATCATTATTGTTGGAACCAGACCCAGTGATCCAATGTCAGGGCTCTGTTGTGTAAACCGCTCCTTTCTCTCGTGTTTTTATAAAGGGCTTCTGTCTGGGCTGGACCCAGTTCTCACATATAGAAGATGCCACTGTAGACAGGACCTTTCTACATTGTATTCTGTAGTAAAGCATCGCCACAACATCGCCCAATTGTATCTGTTATTTTTGGTTTAACACACACTGATTCCTACTAATAAATATTTCAAGTTTTACCAAA