Transcript asmbl_194935

Sequence
Transcript Sequence for observation asmbl_194935 of TGE0006272:
CTCATTTCCGGCCACCTCAGCGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAATGAAATAAATACTTCTAGAATGTTTCCTTCAGTGTGAAGTTTTGTTACCTAGTTTATTTATGCACACATGTCCTTCCAGGTGTATTTCTACCTAACCTCAGTGGGTTAATTAAAAAAGGAGAAGGCGGGGTATGGAATGACAAAGGAATAGGAAAACGGTTTAAGGTTACGATGGTAGCAAAATGAGAGAAAAAACAGTCATAATACGGCTGCTGCTTCTGTTCTTTACTGGAGATGGTGGGAAACGAAGATGAAATGTATCGGCAGCCAAACAGGCCTCTGAAATATAATGCCATAAGCACTGTCCAGGGTTTTGGGGGACACACTGGGAAAGGACACCTAATTTGGGAGGGAATGTGATAAGAAGAGGCAAATGGGGTATTCTAGACGGAGTCAGTGGCTTGTACAAAGTCACGAGTTAAAAGAATAAGGCATGTTTGGGGGATTGTAATTAGCTTGGCTCAACATAACCCGAGGGTAAGTGTAGGCATTTGAGACTGGAGGAAGAGCCAGGCGAGGCGACTGTCATAAAGTCTTGTCTATCGTGCTGAGGAGCTTAGACCACACTAATGTCAGTGGCAAGAGATGACGTCAGATTTATAGTTTTCAAATGGCCGTTGTGACCGTAGCGTAAAGGATGTATTACAGGGGGATAAGCTTGGAAGTAGGAAGGTGGAACTGAAAAGTCATCAAAGGTAGAACGAGACATAGGAGACAGGGTTCAAGTGATTTTCAAGAAGAGAGTTATTCCAGATACCAAATAACTACTGTTTACATGATGCTCTGTTAGCTTATTTAATTCTCATGTTGACGTTTTGAAGTGAGTACTGTTCACGTGATATGGATGAAGAAACTTTACGAAGGCTACCGCTCTGGCACAGAAGACTTCACTGATTTGTCCAGGGTCGCAGAGCTGGGAAGCGATGGAGCTGAGGTTTGAACCTAGGCAGGTTCAAATCAGTCTGCTCTTCTATGTGCCACCAAGAGGTCAGATAAATGAGTACCCAAAAAGGTACTTTGAATTTAACAAATAGGAACTTAATCATACAGGCAGAGGTAATTCCAGAGACGTGGGGATAGACGTCGGATCACAGTGGGTTAAGATCGTGTGAATTACCAGGAAGTGAAAATGTAGAGCTACTCTTACAAGTAGTTTTTCTAGTTGTTGTAACACGGTTTCCTTATGTGCTTTAATAAATTTCATGGATGTTAAAATGTAGCAAAATTTAGCAAATTATATATACATCTGTTCATTTAAATGTCTAACAGTGGTTCTTAAGCTTTTTGGAAAACCTTTAAAAATCTGATAAAGGGTCTGTGTCTTTACCCAGAAAAACATTCAAGCGTACACACGTATCAAGTGTCACACTCTCTGCCAGGGAATCCAAGAACTCCACGTAGCCTGCTCATGACCTCGTGGCCCATGGTCCCCCACTTAAGATCCCCAGATATGTAGGAGGTAGAACTCAAAGGTGAACACGATAATGTAAAATGGACATTGCTGAAGAAGGATGGAGATGTACGAGAAGCTGCAACAGAGACAAATCACTGGCATCACGTGCCGCAGTGGTTTGTGGAAGTAAAGGGAGAAAGCACTAAACGGGGGAGTCAGGAGACTTGGCTTCTCGACCCAGCTTGCCCCTCTGCAGCTGCGAGACCTGAGCTCCGTTCCTGCCTGCGAAATGGGAACAGTCATAGCGTCGCCTTCATCATGTCGTCACGAAGGTTTCACGAGATGACGCGTGGGATGCACTTGGCACGATGAGAAGCTCGGCAAATGTTAGGTTAGGAATCGTTAGCAGTCCCAGAAGACATTCCTCGTTCCCTTTTTACAG