Transcript asmbl_19481

Sequence
Transcript Sequence for observation asmbl_19481 of TGE0006793:
AGCCAATCAAGACGAGATGTGGAGAAGAGGGGCCGCGTCAGCCAGTCACATCCCGCAGGCTGGGTTGGGCGGCTGACGCGAGTGCGGGCCGCAGCCAATGGGCGTGCCATTGCCGGTCCGCTTTTCCGCAGCCGGCCTGGGGCGGTGGGAAAGCGAGTGAGGAGAGCGCGACGACGGCGGCGGCGGCGGTGGTGGGTCCATCGCTGGACGGCTAAGGGGAAAGCCAGGCCTGAGCTTCTGCATCTAGGATCAGAATGGTTTCAATCCCAGAATACTATGAAGGCAAGAATGTTCTTCTCACTGGAGCTACTGGTTTCCTAGGGAAGGTACTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAAGTGAATTTAGTGTATGTTCTGGTGAGGCAGAAAGCTGGACAGACACCCCAAGAGCGAGTAGAAGAAGTCATTAGTGGCAAGCTCTTTGACAGATTGAGAGATGAAAATCCAGATTTTAGGGAGAAAATTATAGCAATCAGCAGTGAACTTACCCAACCTATACTGGCTCTTAGTGAAGAAGATAAAGAGATCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTAAGGTTTAATGAAAATTTAAGAGATGCTGTTCAGTTAAACGTGATTGCCACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAACCTGGAAGTGTTCACACATGTGTCAACAGCATACGCCTACTGCAATCGAAAGCATATTGATGAAGTAGTCTATCCACCCCCTGTAGATCCCAAGAAACTGATAGATTCTTTAGAGTGGATGGATGATGGCCTAGTAAATGATATCACCCCCAAATTGATAGGAGACAGACCTAATACGTACATATACACAAAAGCATTGGCAGAGTATGTTGTACAACAAGAAGGAGCAAAGCTAAATGTGGCAATTGTAAGGCCATCAATCGTTGGTGCCAGTTGGAAAGAACCTTTTCCAGGATGGATTGATAACTTTAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAGTGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACATGAGTCTTGCGGCAGCCTGGTATTCCGGAATTAATAGACCAAAGAACATCATGGTGTATAATTGCACAACAGGCAGCACTAATCCTTTCCATTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCAGTACTGGATTGCTGTAAGCCATAAGGCGCCAGCATTCCTGTATGATATCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAAAACAATAACTCGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGACAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACTTTTAATATTGATGTGCGGCAGTTACATTGGGCAGAGTACATAGAGAACTACTGCATGGGGACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGCCTCCCTGCAGCTAGAAAACATCTGAACAAGTTGAGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGTATTTTTATTGCAAGATCACAAATGGCAAGAAACATCTGGTACTTTGTGGTTAGTCTGTGTTACAAGTTTCTGTCATACTTCCGAGCATCCAGCACTATGAGATACTGAAGACAAGAATTTAGCATTAGAACATCTATGCATATGGTGGTCTAAATGCACAAAACGTAAAATGTACTTAAGTCATGTCATCTTTTGTCAAGACATTAAACCATCTTAGATCAGAGAGTGGAGTAAATTATGGTACATTTTATGTAACGTTTTAATGTTTATGCTCTTAAAAATCTAGTGAACACACTGTGGTATGCCATCTCAATTCTGCAATAGCCACCAAAACCATGACTTAATATTTTGATCCCTCGGGAAAAGGGGTGGGGTGAGGGTAGGAGTGGGGATATAGGAACACTGACCAGTATAACTGTGCAATTCTGGAACATATTAATTAAAATATGCCTTAACATATAGTGAATTTCTAATTCTAATATTGAATGCAATGGAAAGCATTTATTTGGACAGGAATACGAGCTAAGTTGGTAGATATTTGATTCTTCAGTGTTTAATTTTTTTCATCAGTCGATGTGGGTTTTAGTTTTGTTCAAGTTATAGCCAAACTATTTTCACATCATCCTGTAAGTTATCGAGTGGTCTCAGACATGAAAGATGTGTTCTCATTTTTCTTTCTCTGATTAGAGGTCTCATGCATATCATTTTTCTATAAGCAATCAGTTGCTTTCATAATCAGAAGGCTATAATTATTCTAAAGATCCTAATAGATCGAAATGGGCTTGAAAATCCATATCAACATATGCTATGTGTTTTTTGAAGGAAAATTAAAATGAATTCAGTAAGACTTGGCATCAAAAATTAGGATACATTTTTTTGTTCACATTATGGCAAATAAAAATCCTGTGAGATGTTGTTCATGTTTTTAAGATGGAGGATTTCTTGAGACTTTGGCAAATGGGGGTGGGGGGGGCGGGGTTGAGGAGGGATTCACCGTACTTGTGCTCTCCTCCCTTTATAAATTTTATTAATAAGGCTTTTAAAAGGCTTATGTTATCTTTCCAGTGAAAACTGAGAGTGCATTATTATGGAAGAATGTATTTGCAGGTAGTTATAACATTAAGAAAATGTTCTCACATGTGTAAACACATACTAACTTTTGACCTCGAGAGCTGAACTTCTTCAAGAAAAATAAAATAATGCATAAAATAATGTGTATAAAATTAAAAGACTATTTACATACCACATAAAGTAGCAAACTCTTGAATGAGTTTGAAGATATTTATTTTTTCTGCATGTGGTTTTAGCTTTAGAAAGAAATACATTATAGAAACAAGCAATAGCAAGAAAATTAATGTATATTTTAATGATACATTATAATTCCCTTTAAACCTTAATAGTAGTTAATTCTCCTTACTGTTTTAACATATATTTGGTTTAACAGATTGATCAGCATAACATGTTCTAATTTAGCTGCTCAAGTTGTAATATATTTAAATCATCAACAGTGTATCTTGAATATGTTTAATGAGATCCGTTCACAGTACAGAAGTTACATAGAACTTTACATCTGAATTTTCTTTGTCAATTTAAATGTAATGTATAAGAAGTTTATTTTGTTATTGTGAAAAAACTAAATGTAAAAGAAATCACCTTCTTCCATGCAGGTGTGTAATCTTGAAAAGGAAAAATGCTTCCATGTTGAAGCCAGATTTTCTGCAGTAAAACTTTTCAGCATTATTTTAAAAGAAATATGTATATAAATACATATGTATTCTTTGGAATGATACAAAAGTCTTTGGTCTAGGACCATACCTTGTATAAGGTGTGAGAGACCATAACAGTGTCTAAAGATGGAATAAATGGTGATGCCTTTGACTTAAAGTGGCCCACGTAATTAACTATAGATCTCTGTACATTGAGTGCTCCATCTCTCCAAATACATTTCCATAATGTATTGAAAACATGCTCATATTTGTATGATTTTTATACTTCTGCCAAATGTACTGAGAATTAGATGAATTGCCTTTGTATCTTGAAAAAGAACCAGGTACATCTTCAGTAGGCATGTGAAATACATATGGAGTGTATGTCTTTTGATCTGTGTCATTTTTCTTATAATCTAATTTTAAAAAATGCCGACTGGGAGTGTACTGAGGCCACTGCATTAATTTTGTGTGTTTGTTTAGAATTCTGTTGTCAAAAGAAAGCTGATGAATAAATTAACATGTCATTGCAGAACTTAAAGTTTTAAAATTAGCATAAAGTACATATAGATTGTTAATCCTCACTAACTAGAATTCAAGTATAACTTGAATTTAAAGATTTTGGAAATCATTTCTGTTTGCGTCATTTGCTAGACATGGTGTTTAGTTCTGTTTGAGTATATTTTTTTCTACACAAACTCAATTTTTAACAGGATAGCCTATTAAATAAATTTAATATTTAATTCATTTGATAAAGCTGTATTGTAAAACATTTGTTTTTTTTCCCCTTTTCACTCTTGAGTCTTATAGTTCTGGCATATGCATCTGTCACTTGTGATGTCACTGTAATTGTATTGAAATTTGACCTGGCAACATTGCTATGTCCTAAAATTCAACACAGAAAAGCATGGCAATATGTTCTTTGACTTAAGGATGGTATAAAATAAACAGTCTCTGAGTCTGTGTAATAAAGCTTGGAAGCAGGGAGGAAAAAATCTTATTTCTCCCCTTTTTTTGTGTTTATAGGAACTGGTTCAGAGTTTTTGGCTTTTTGTTTTAAATGTAAATTGATAATCTTTTATAAGAAGTAAATAGAAGCATTATTGGGTGCCTTTGTTTGTAAACCAAAAAGTAATAAATGAATCCCTATATTTCCATTTTA