Transcript asmbl_191161

Sequence
Transcript Sequence for observation asmbl_191161 of TGE0006234:
GGCTGCGCGGGCCGCCGGCCCGGCCCTCCCCGGTCACGTGGCGGGGACCGCGGCGTGGCGGCGGCGGTGGCGGTAGCGACGGCAGGCCGTAGGGCGGTCGGAGGGTTTCCGGTTCCGGTGTAACGTTCGGGCTCCGTCTCAGGGGCTGAAGTTTGTGGGGTGCGGTATTGAATCCTGTTTGAGCTGTCCTCCTTTTCCTGCAGAATGGCACTGTCTAAGAGGGAGCTGGATGAGCTGAAACCATGGATCGAGAAGACAGTGAAGAGGGTGCTGGGTTTCTCAGAGCCCACGGTGGTCACAGCAGCACTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCTGACCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGCGACAGGAGCAGAAAACGAGAGCTAAAGGAAGTGTTTGGTGATGACTCTGAGATCTCGAAGGAATCATCAGGAGTAAAGAAGCGACGGATACCCCGTTTTGAGGAGGTGGAAGAGGAGCCAGAAGTGATCCCAGGGCCTCCCTCAGAGAGCCCTGGCATGCTCACTAAACTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATAGAGGAGAGAAAAAAACAACTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTACTTCTTCCTCCCAACCAGAGCGACTTCCAATTGGCAACACTATTCAGCCTTCCCAGGCAGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTACAAGCCCGCATCCAGGCCCAGCTGGCACTGAAGCCAGGGCTCATAGGCAATGCCAACATGGTGGGCCTGGCCAATCTTCATGCCATGGGCATTGCTCCCCCAAAGGTGGAGTTAAAAGATCAAACTAAACCTACACCACTGATTCTCGACGAGCAAGGTCGCACTGTAGATGCAACAGGCAAAGAGATTGAGCTGACACACCGCATGCCCACTCTGAAGGCCAATATTCGTGCTGTGAAGCGGGAACAATTCAAGCAACAGCTGAAAGAAAAGCCATCAGAAGACATGGAGTCCAATACCTTTTTTGACCCCCGAGTCTCAATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCCCAACGATTACGGACAAAGGCTCAACTGGAAAAGCTGCAGGCAGAGATCTCACAGGCAGCTCGAAAAACAGGCATCCATACTTCAACTAGGCTAGCCCTCATTGCTCCTAAGAAGGAATTAAAGGAAGGAGATATCCCTGAAATTGAGTGGTGGGACTCTTATATCATCCCCAATGGCTTTGACCTTACAGAGCAAAATCCCAAGAGAGAAGATTACTTTGGAATCACAAATCTTGTTGAACATCCGGCCCAGCTCAACCCTCCAGTTGACAATGACACACCAGTTACCCTGGGAGTATATCTTACCAAGAAGGAACAGAAGAAGCTTCGAAGGCAGACAAGGAGAGAAGCACAGAAGGAACTCCAAGAGAAAGTCAGGCTGGGCCTGATGCCTCCTCCAGAACCCAAAGTGAGAATTTCTAATTTGATGCGAGTGTTAGGAACAGAAGCTGTTCAAGACCCCACGAAGGTAGAAGCCCATGTCAGAGCTCAGATGGCAAAAAGACAGAAAGCGCATGAAGAGGCCAACGCTGCCCGAAAACTTACAGCAGAACAGAGAAAGGTCAAGAAAATTAAAAAGCTTAAAGAAGACATTTCACAGGGGGTACACATATCTGTATATAGAGTTCGAAATTTGAGCAACCCAGCCAAGAAGTTCAAGATTGAGGCCAATGCTGGGCAGCTGTACCTGACAGGGGTGGTGGTACTGCACAAGGATGTCAACGTGGTAGTAGTGGAAGGGGGCCCCAAGTCCCAGAAGAAATTTAAGCGTCTTATGCTGCATCGGATAAAGTGGGATGAACAGACATCTAACACAAAGGGAGATGATGATGAGGAATCCGATGAGGAAGCTGTGAAGAAAACCAACAAATGTGTACTAGTCTGGGAGGGTACAGCCAAAGACCGGAGCTTTGGGGATATGAAGTTCAAACAGTGCCCTACGGAGAACATGGCTCGGGAGCATTTCAAAAAGCACGGGGCCGAACACTACTGGGACCTTGCGCTGAGCGAATCCGTGTTGGAGTCCACCGACTGAGGCCGCCGCGGGCCCTGGCCTCTGCCCGCTGGCCTGCGTCTCTTCAGTCCTCCCCCTCGTTCTCCTTCCCAGCCCAGCCCCCCGTGTGTGTGATCTGAGAACTGTGCCACGCCGACATCGGGACAGAAGGAGAGCACTGGCTCCCCTCCCGTCAGCCTGGTGCTGCCCTTTCCTCTATGTGCATACGATTAAAGAGTTATTTTTAAAGGTGGTATGATATTTTTCACACACTCATAGGATTGGAGTTTGGGTCTTCAGGTGATCCTTTCTCCAGACTTGTAGCAATTGCTGTGGGAAAAAAAATTTGTCATTGGTATTTATGTATATATGAGTGGGTGGAAGGAAGGATGGATTTGTGTTTTTGAGGGCTAATGGACATTTCTGACCTCATCTTCGAGCAAGAGTGATAAATACTGTTTCTTGGAGCAGAGTGAAGCAGGAAGAGGTGTTAAGTGGGTGAGGGACAGGGGACAGATGATGTCCAGCCCCAGCCTTCTATAGAGTCATGAGGTAGACAGATCACCTCTGGTCTCGGCTAAGACTCTAACAGGAAGTCACTTCCTCAGGCAGGGTACACATGAGAATGTGTGTTGTGGACGAGGTGGACACGGGACGTCCAAGGAGGGTGCTGCGGATCAGTTTGTAAAGTAGAATTAAGATTTGAGAATTTAGCCTATTTCCTTTCTTTACTAATTAAAGAAAAAACAATCTTTTTCTAAAAGA