Transcript asmbl_190965

Sequence
Transcript Sequence for observation asmbl_190965 of TGE0006217:
CTGCGGTCCTCGGGCAGCAGTTTCTCTATGCTCTGTTCCTCTTATCGCGAGAAAAAAAATGCGAGACGAAGTAGAGTGAAAGAGGTCACACGTTATCTTCTCGCGAGGTTTGCGAGCGACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAATATTTTGGTCAGTGAGATGCTTCTTGTCCTTCTTGCTCTGCATTTTAAGTTGGTCCATGATCACTTTTGATTCAGCAGTTTGCTTTTAATAGAATTTAGTGCCTGACTAGAGACTACCAAGTTACAGTTTAAATTTGTAATTTATTCTACCATCTTGCAATAGACTGACAGTTGAAACAAGGTTTTTCAGATTGCATAATTTTCTGAAATATTATTTCAATCTTTGCCATATGGGTAAAAATTAAAGATGCCATTGAACTGATAATCTTGTTTTAAGGTTACTAGTGGTAAGCTATTTCTGGCTAATAGGTCATGGGAAATTTAAAGCTTTTCAATATTCTTAAAATAACTAAAAGAAATATTGTATATCACATCATTTACTATTATCATATCTGTAGAAAATATTATGGACTCAGTGTATCATAAAATCACTCTTAATAATCTGGCAGATAAATCAGCAAATTATGCCCTTCTGTAGGTTTGTCTCATTTTCCCATACTTGTATAAGGATTTATTTATATACAAATGGACAACTTACCTTATAGGAAATATTGTATGAAAATATGTATCATGTGGGTAATTGCTATTTTCACTGATTTCCTAGGATTTTAATTTATGTAAATTTGACTTCATTATCCACCAATAAATTAGATTGACATCTTTATTGTTACTTAAAA