Transcript asmbl_190159

Sequence
Transcript Sequence for observation asmbl_190159 of TGE0006181:
CCGCCTAACTATACCCAGGAACGGGCGCAGTTTCCTTTTCGTCTTTAGACATGGGCACACCACAGAAGGATGTTATCATCAAGTCAGATGCACCCGACACCCTATTATTGGAGAAGCATGCAGATTATATCGCATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGTAGGTCAGTATTTATGGCCCGTGTTTTTTAATAATATCCAACTCAGTGCATGCCAAGGACTGATGATAGGTCCTTGAAATGCTGTGAAGTACACCTTTGGATATGTGAGGTTGCAGGAACATAAATATTTTAACACCGGTTCTTCCCAGTACTCTTTTAGAGGTCTTGGCAGACAGATTCCTTTCTTGTCTAGATTTGTAAGAGGTTTAAGGTGCAGAATAAGTTTCTCCTTTTGGAGTTGAGGTAAACTTTCAAGGTCAATGATGTGTTGGCATGTATTACCTGAATTTATGGCTGATGTGTAATAACACGAGCTCTAGAATTACGCTGAGACCTTGAAAAACTTACTTGGTTTCCTTTCTGGGACAATCTTAGAAAATTAGTGAATGAGTCAACTGAAAAGTATTTTTCCCTGGAGTATCCAAACAACTGGATTATATATACCATCTTGGAAAACATCGTTGATAAGTTCTTAAGTGTTTGGTTCCCATAACTTTGTAGTTACGGAGTTGTTAGGGCAATGTTTATTTTTTATCTACTGCTCACTTGATTTCTTTAAAACTGAGTTTTGGGTTCACAGCAAACCACTAAGACCACTCACTGATTCAAAACCTTAAAATATAAAGCATTGGTGACCATAGCAAAAATTTGTTTCTGGAATCTTCGTGCCAGTTTTTTTTTGATTTGTTTTAATGGCTCCATTATTAGCCACTCTTACCCATTTTATCTTTTGTATGTATTGGCCATTTTGGTTTGCAAGTAGTTAAATCATTTACTGATAAAAAGGTTTCATAAAGAGTATATGTTAAAAGAATGTCTAATAAGTACATTTCTTAAATGTTTTCCTCGAACTTGTGAAAGGTCTTTTTCTGACTTACGTTTGGCTTTTGGAAGAGATTAAAGCTGTATTTGTATTGTCAGTAAATTGAGTTTATCATGCTTTTCAAGATAGTAGTCCCCTCATGCCCCAAATTTGAAAGCCACAAGTTTAAACTTATTGATGATGGATTAAGTGAAGTAAAAAGTAACTGGCTAGCTTTCTGTGTTCAATCTCTACCCCCGCATCAATTCAAACGGCACATTAATTGTGTATTTTAGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTGCTTTATTGTGATAAATGCATAAATTCAATAATGTTTTAAATGAATGTCTTCTAATAGTGTCCAGAGTGCTTTATTCTGTTTCTAAATCCTATCTATGAAGTTAGTGCTAATTGCATATTTAAGAAGAGTAAACAGGTAAATATTTCCCAAAGGTCATTTGTTG