Transcript asmbl_190157

Sequence
Transcript Sequence for observation asmbl_190157 of TGE0006181:
CCGCCTAACTATACCCAGGAACGGGCGCAGTTTCCTTTTCGTCTTTAGACATGGGCACACCACAGAAGGATGTTATCATCAAGTCAGATGCACCCGACACCCTATTATTGGAGAAGCATGCAGATTATATCGCATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTGCTTTATTGTGATAAATGCATAAATTCAATAATGTTTTAAATGAATGTCTTCTAATAGTGTCCAGAGTGCTTTATTCTGTTTCTAAATCCTATCTATGAAGTTAGTGCTAATTGCATATTTAAGAAGAGTAAACAGGTAAATATTTCCCAAAGGTCATTTGTTG