Transcript asmbl_57698

Sequence
Transcript Sequence for observation asmbl_57698 of TGE0010302:
CCTTTCCTCCACCCCCATCCCTTTTTAGGACCTTAAGAAATATTTCGACAGCTGCAATGGTGACCTAGATCCTGAAATTGTGAAGTCATTCCTCTTCCAGCTCCTAAAAGGCCTGGGATTTTGTCACAGTCGCAACGTGCTGCACAGGGACCTGAAGCCCCAGAACCTGCTCATTAACAGGAATGGGGAGCTGAAATTAGCCGATTTCGGGTTGGCTCGAGCCTTTGGGATCCCCGTTCGCTGTTACTCAGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCGGGGCGGCCCCTCTTCCCCGGCAACGACGTGGACGACCAGTTGAAGAGGATCTTCCGACTGCTGGGGACACCGACCGAGGAGCAATGGCCTGCCATGACCAAGCTGCCAGACTATAAGCCCTACCCGATGTACCCAGCCACAACGTCCCTGGTGAACGTTGTACCCAAGCTCAATGCCACAGGGAGGGACCTGCTGCAGAACCTCCTGAAGTGTAACCCTGTCCAGCGCATCTCGGCGGAGGAGGCCCTGCAGCACCCCTACTTCTCCGACTTCTGCCCCCCCTAGGCTCCTGGCCCCTGGCCGCCAGGCTGCGGCCTGGCTGTTTTGGTGCCCTCCCGGGAGGGATGCACGCTGTGCTGAGCCCCAGCTGTGCTGGGCCCGCCAGGGTGGAGGCGCCCCCGCCGGGGTCTCTCTCCCTCCACGGACTTTATTTAATTTCATAAAGTGGCTCCTTTCCCACC