Transcript asmbl_190029

Sequence
Transcript Sequence for observation asmbl_190029 of TGE0006178:
AGTAGACCTTGCGCACGGGAAGATGGCGGCGTCCAGGTGGCGGTCTTGAGGAGACCGAACCGGTATGGCTTTGGCGTCGGGCCCCGCAAGGCGGGCGCTTCGTCTACCTGGAAGGCTCGGCTTTGGGGGCGACGGGACCCCGAGACGCGGGGCGTACGAGTGGGGCGTTCGCTCCACGCGGAAGCCCGAGCCTCCTCCCCTGGACAGGGTGTATGAAATCCCTGGACTGGAGCCCATCACCTACGCGGGGAAGATGCACTTCGTGCCCGGTCTGGCGCGGCCGGTCTTTCCGCCGTGGGATCCTGGCTGGACGCACCCAAAGTTCCGCCGCGCGCCCCCGATCCAAGAGCATCCGCTGTACAAGGACCAGGCCTGCTACACCTTCCACCAGCGTTGCCGCCTCCTCGAGGGTGTAAAGCAGGCTCTCTGGCTTACCAAGGCCAAGTTAATAGAAGGCCTTCCTGAGAAAGTGCTTAGCCTTATTGAGGATCCAAGGAACCACATAGAGAACCAAGATGAACGCGTTCTGAATGTGATCTATCACGCCCGTCTCTGGCACTCCACTGAAAACATCCCCAAGAGAACGACCTACTGCCCAATCATTGTGGACAGTCTGTTACAGCTGTGTAAATCCCAGACTTTCAAGCATCCTTCACTAGCCAGGCGGATCTGTGCCAAAAACTACACGTTATCCACCACTTGGAATCGAGAGTCTCTTCTCCTTCAGGTCCGTGGTTCTAGTGGAGCCCGACTGAATGCCAAGGACCTTCTGCCCCCCATTGCCTCCAGAGAGGAGGTAGAAGCTACTAAGAATCATGTTCTTGAAACCTTCTATCCCATATCTCCCACTGTCGATCTTCAGGAATGCAATGTTTATGATGTGAAAGACGACACAGGATACCGGGAGGGTTATCCTTATCCCTATCCCCACACCCTGTATTTTCTGGAGACAGCCAATTCACGACCATACCGCTTTCAACCAGATCAGCTGCGGGCCAAGATGATCCTGTTTGCCTTTGGCAATGCCTTGGCTCAGGCCCGGCTCCTCTATGGGAATGACACTAAGGTTTTGGAGCAGCCAGTAGTTGTGCAGAGTGTGGGCACCGATGGACGTGTCTTCCAGTTCTTGGTGTTACAACTGAACACCACAGATCTGGCCTCTAATGAGGGCATCAAGAATCTGGTGTGGGTGGACTCAGACCAGCTCCTCTATCAGCATTTTTGGTGTCTCCCAGTGATCAAAAAGAAGGTGGTTGTGGAACCTGTTGGGCCGACTGGTTTTCAGCCAGAGACGTTCAAGAAGTTTTTAGCTTTGTATTTGCACGGTGCTGTATGAGCCAAGGACTGTTCTGCAGCCTCACGTACCCCCTCGCTTCAACCCACCGAAGACCCTGCAGCCTGGGCAGGGCCTGGGGTCTGCCCGGAGCCTCAGTGCTCTTTTGGCCTGGTGGGCTCGCTGACAATAACGAGTGCTTCCAGTGCACTGGAGTCTGTGCTTGGTGTGAGGGTGCTGTTGGGAGGGACATCCAGTTTCATGTGGGCCCACACCTTGAGCCTGCCGCCATATAAATGCAGGCCCTGGAGTCTGACCTGCCGCATCTCTGCCCACCACCCATTTTGTGACTTTAGATAAAAGTCTTCATCTAAGTTTCAATTTCTTCATCTGAAACTTGGGCCTAACATAACCTACCTTATTTTGAAGACTATAGCTTATGTATGTGTATTGTCTGTCACATAGTAGGTGCTCTGTGATGGTTGCTCAGTTCTTTTGGGGTTATTTAAATTGTGGACACATTCACAATGACTGCAGAAATTCTGAATAGAATATTCATTGTAGATTTCTCAGCTAGTGTCCTGGTTACTGGACCAGTACACCCCTGGTTCAGCTGGCCTCCTATTTGTTCTAACAACATCCGGTCCTGCTCTGGGCCAGGTACCTATACACAGCATCTTACTTAATCCTTACACAACTCTTGACAAGGTAAATGTCATTTCCATATGCAATAAATATGTTGAATACCTACTATGTGCTGG