Transcript asmbl_189903

Sequence
Transcript Sequence for observation asmbl_189903 of TGE0006166:
GGCCGTTGCTGCTGTACCGGTGCTCGGCTCTTGCGTGTTCATCCGTTACACCTAAGTGGACGGATAGAAAGTCTCAGACGCTTCCCCGAGTTATCTGGATCGGATAAAGACCGTCGTCTACTTGCTCTAAATATGCAGAGCAACACCGGGTTCCTCCTCTGTGGAAGCCGATGGCTGACGCCTAGTCAGGAGTTGTAGTACCAAGATTCCAGTTCACCTTACACGACTTGCTAGAGAAGCAGGAAGTTGCTTTTTGGGAGGAACACAGGACAGGAAGGAAAGATACCTCGCAGGGCAAGAAGCGAGGGCGGGGGTGTCTTTGGGCTAGACTGGGCTGAGTTCTGGCCCTTTAAACTCGAGGGGGAGGATCCGGAAGTGGATGGGCGGAGCGAAGGATCCTGGCATATAAGAGGGCCCAGCCGCGCGGGGTCTCCAATCTGCCATTTTCTGTTTCCGAATAAGTCTCTTGTGTCCCAAATTTCCTCTGTTTTCTTCACAGGCTATAGTCCGTCCGTTGGCTCACCACCTCAGGGGAACGATGGCCGCAGAGTCAACAGCCACTGCCGCCATCGCCGCGGAGCTGGTTTCTGCCGACAAAATTGAAGAAGATGCTCCTGCTCCTTCTACCTCAGCAGATAAAGTAGAGAGTCTGGATGTGGATAGTGAAGCTAAGAAGCTATTGGGTTTAGGACAGAAACATCTGGTGATGGGGGATATTCCAGCAGCTGTCAATGCATTCCAGGAAGCAGCTAGCCTTTTAGGTAAGAAGTATGGAGAGACAGCTAATGAGTGTGGAGAAGCTTTCTTTTTCTATGGGAAATCACTTCTAGAGTTGGCAAGAATGGAGAATGGTGTGTTGGGAAATGCCCTTGAAGGTGTACATGTGGAAGAAGAGGAAGGAGAGAAAACAGGAGAAGAATCTCTGGTAGAAAATAATGATAACATAGATGAAACCGAGGGCTCAGAAGAGGAAGATAAAGAAAATGACAAGGCTGAAGAAGCACCAAATGATTCAGTTCTTGAAAACAAGTCTCTTCAAGAAAATGAAGAGGAGGAGATTGGGAACCTAGAGCTTGCCTGGGATATGCTGGATTTAGCAAAGATAATTTTTAAAAGGCAAGAAACAAAAGAAGCTCAGCTCTATGCTGCACAGGCACATCTTAAACTTGGAGAAGTTAGTGTTGAATCTGAGAATTATGTCCAAGCTGTGGAGGAGTTCCAGGCTTGCTTAAACCTGCAAGAGCAGTATCTGGATGCCCATGACCGTCTCCTTGCAGAGACCCACTACCAGCTAGGCTTGGCCTATGGATACAACTCTCAGTATGATGAGGCAGTGGCACAGTTCAGCAAATCTATTGAAGTCATTGAGAAGAGAATGGCTGTACTAAACGAGCAGATGAAGGAGGCTGAAGGATCACCTATTGAATATGAGAAAGAAATTGAGGAGCTGAAGGAACTGCTACCTGAAATTAGAGAGAAAATAGAAGATGCAAAGGAGTCCCAGCGTAGTGGGAATGTAGCTGAATTGGCTCTGAAAGCAACTCTGGTAGAGAGCTCTACTTCAGGTTTCACTCCTAGTGGAGGAGGCTCTTCAGTGTCCATGATTGCCAGTAGAAAGCCAACAGATGGTGCTTCCTCATCAAATTGTGTGACTGATATTTCTCACCTTGTCAGAAAGAAGAGGAAACCAGAAGAAGAGAGCCCCCGAAAAGATGATGCAAAGAAAGCCAAACAAGAGTTGGAAGTGAATGGAGGCAGTGGGGATGCGGTCTCCAGTGGAAATGAAGTTTCGGAAAACATGGAGGAGGAGGTGGGCAGTTAAGCAGGGCTTGGACTCTTGCCTCATTTCCCCTTGTTCTCAGGCCTGGGGAAACCAGTCCTCCCAAGTGCATGTTCTCACCTTGAGCCTGTTTGGATTGCTTGAGTGCAACAGGAAACAGTTTGGTTATGGAATGTAGGACGTCTCACTGACAAATGTAAACTTTATACATAGCACACAGGTCCCCCTCTAATGAATGTAGGGGAAGATACTTAATGGCAAAACCATTGGGTCACTTCTGCTTGCTCTTTTCCATGTTTGAACATTGGCTCTGCCAGCCCTGTTAGAGAATTTAAGAAATGGCTTTTATATTTTGGTCATTGCCGTGTTAGTGTAAGGAGCAAAGTGGAGTTGAGGGGACCTGTGTTTACTTCCTCTGACTGAAGCCTACTCGTTGTAAAAGATAGAATGGCTTAAAGTAGGGTCACTTATGCCCAGGCTCCCTGTTTATCTTCCAGGCTGAGAATCAGGCTGAAAGCCGGGCAGCAGTGGAGGGGACAGTGGAGGCTGGAGCTACAGTTGAAAGCACTGCATGTTAAGAGGGAGCAGAGCCTTCCTCCCAAGGGAAAGTGTTTTGTATATAATGTATTTTTTCACTTTTGGGGGATTCTTTTTGTATAACTTCAATAAAGATTGTAAGCAAAGGTTGAGGCTTTGATTTTTTTTTCCCCTCTTAAGTATTGGCTGAATCTGTGCCTTGGAGCACTTGTGTTTTATATAGTGGCCAAAGGTACTCCCCACTCTGTACTATCTCTGGAAAGTTATAATAATCCAAATTCCTGTCTGTTTAATGTGGAGGTGATCAGGTGTGGTTGCCAGCCCTTTGTCTTTCAATGGTGCTATTTTTGTTTTAAATACTTGACTGAACCCAGCTGTCTTGCAAACTTTCAGTGGTGCTGTCCCTGGATGGGAGCTATAAAAACAAGACTTGGTGAAGATCTTGCTCTTTGGTGCTGATACTGTATGATGGACTCTGAGCTGATAACAGCCTCTAAGCCAAGTCTTGAATGGTACCAAGTAGTCTCCAACTGGGGCCATACTCCTGTTCTAGTAAAAGAACTCTGAGGAAGACTTGGGGGTGGGGTAGTCCTTGAGGAAAACTGGTGTGCTCATTGTAGAGAATTGAGATTTCTGGTTTGAAAGTGGCTAAGGGACTGACTACAGTGGACACTTGGATGTGGTTGGAAGAATCTGGGGAGGCTGGCTGGTTGAGTTATATTATTTTCTGTACAAAGAAAGTTGAAATATATCAACGCTAAACTGTTACCTGTCTGCAGTTTTGACTTCTCAAATAAAGATGTTATAAAAA