Transcript asmbl_189718

Sequence
Transcript Sequence for observation asmbl_189718 of TGE0006146:
CCGAGTCCCCGGCGGCGGCGGCGGGGCAGCGCACGGGCGGACTAGTGAGCACCGAGGGGCAGGCGCAGGAGATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTACTTTTTTTCTAAAAAGAATCAGGTTTTTACATTTCCTTGCCCTACTGAAATAAAAAGTGCCATACTTATCTTTTAAAGGAAGGACTTGATTTGCTTTCTCTCTGGACTATTTTTGTACTTTACTAATCTAAACTATCAGAAAATACAAGTCTACCAATGATTTCGTAATTTTGAGACATAGGTTAGTTTAGGTAGAGGAGGATGTGCCAAACTTTTTCTTCAGATGCTTTCTTCTCAACCAATTTACAACTAAGATAGTGTCCTCTAAGTGATTACTCTGAATTTTGATTTAAAGTCTATATAGGCCCAAGAAGTGAATTATACTACATATCATTCTTTTCTCAATAAAATATAATACAGTATGTGTTAGGAATTGTGTTGATTTCCTTTATGGTATATCTGTTAATAGGAAAAAGTACATTGAATCAAATAGAAGTATATGTGTATTAAAACAGAGCACTTACCTAAAATTGGGCGGCCTGGATCTTAGCCCTAGATCATTTTCTAGCCAATCCTGTGTCCCTGTGTTGTGACTTTGGACAAGGCACTTGCTCTCTCTGGGCCTTCATTGCACCATCTGTAAAACAAGGGGCTTGAAGTAGATGGTGGCTGAGATCCCTTCCTGCTTTCAGATGTCTCGTTCCAATGGCCTACACCCCTACTGGTCCTGCCAACGTGTTGGTGCTATAAGCTGCTTCAAATATAAAATTGGTTTGTCTGTCATGTATGCTCATTTAATAGCTTATGAAAGGCCTTTTTGTCATACAGCTTTTTATTTCTAGTTTTACGGACTTGATTACTGTAATAATGTCTTGTTTTTAGTCATGTAACTATAAACATATACTCTCTTGATGTCTCAGTAAATTTGCATTTGATAAATATAGTTGATGGGATTTTGTTATTTTATAACATTCTTTGGCTACTCATCTGTCCAGCATCTTATTTACCTAAACACTGTGATCATTGTTTGGAAATCTGTCCTATGGAAAGAATAAAAGCATTTACTTCACAGCTAATATGTTCACAGATTTGAAAGAAGTTTCATTAAAGCACCATTACTCTCTTTACTGGGTCAGTGCCTCCTTGTGTCATCCTACCCGTGTTTTGCTCAAAAAATTAAAAGAAGA