Transcript asmbl_57444

Sequence
Transcript Sequence for observation asmbl_57444 of TGE0006437:
GGTTTGCCTGCAATGAAAGTTCGTTCTCTACAGCTAAAGGACATCCTTTCTGAGCTGCTGTGAATAAATTTGGAATGATACTGTATATTTTCATCTAATGGAGAATTAGCTATACCTTGAAAAAGGATTGCTGCACTGGACAACTTCAGACTATTGCTCACAATGTCATCAAACAGGAGTCAGAATCCCCATGGACTGAAGCAGATTGGCCTTGACCAGATCTGGGACGACCTCAGAGCTGGAATCCAGCAGGTGTACACCAGACAGAGCATGGCGAAATCCAGATACATGGAACTCTACACTCACGTTTATAACTACTGCACGAGTGTTCACCAGTCAAACCAAGCGCGAGGGGCTGGCGTCCCTCCTTCTAAATCAAAAAAGGGGCAGACGCCTGGGGGAGCCCAGTTTGTTGGCTTGGAGTTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGACAAACCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAAGTTCTATACTCAACAGTGGGAAGATTACCGATTTTCAAGCAAAGTGCTGAACGGAATTTGTGCCTACCTCAATAGACACTGGGTTCGCCGTGAATGTGATGAAGGACGGAAAGGAATATATGAAATCTATTCTCTCGCGTTGGTGACTTGGAGAGATTGTCTGTTCAGGCCATTGAATAAACAGGTAACAAATGCTGTTTTAAAACTGATTGAAAAGGAAAGAAATGGTGAAACCATCAATACAAGACTGATTAGTGGAGTCGTACAGTCTTACGTGGAATTGGGGCTAAATGAAGATGATGCGTTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTCGAGTCTCAGTTTCTGGCTGACACAGAGAGATTTTATACCAGAGAGAGCACCGAATTCTTGCAGCAGAACCCGGTTACTGAATATATGAAAAAGGCAGAGGCCCGTCTGCTCGAGGAGCAGCGGAGAGTGCAGGTTTACCTTCACGAGAGCACCCAGGACGAGCTCGCACGGAAGTGTGAGCAAGTGCTCATTGAGAAGCACCTGGAAATTTTCCACACAGAGTTTCAGAACCTGTTGGATGCTGACAAAAATGAAGATCTGGGTCGCATGTATAATCTTGTGTCTAGAATCCAGGATGGCCTAGGAGAATTGAAGAAACTTTTGGAGACGCACATTCATAATCAGGGTCTTGCAGCAATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGTTGGACGTTCATAAAAAGTACAACGCCCTGGTCATGTCCGCGTTCAACAACGATGCGGGCTTTGTGGCCGCACTGGACAAGGCTTGCGGTCGCTTCATAAACAACAACGCAGTTACCAAAATGGCACAGTCGTCCAGTAAATCCCCTGAGCTGCTGGCCCGATACTGCGACTCCTTGTTGAAGAAGAGCTCCAAGAACCCAGAAGAAGCAGAACTAGAAGATACGCTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAGGATAAAGACGTGTTTCAGAAGTTCTACGCAAAAATGCTGGCCAAAAGACTGGTGCATCAGAACAGTGCAAGTGATGATGCCGAAGCAAGCATGATCTCTAAACTAAAGCAAGCCTGTGGCTTCGAGTACACCTCTAAGCTGCAGCGGATGTTCCAGGACATCGGCGTGAGCAAAGACCTGAACGAGCAGTTCAAAAAGCACCTGACGAATTCAGAGCCGCTAGACTTGGATTTCAGTATTCAGGTTCTGAGTTCCGGATCGTGGCCCTTTCAGCAATCCTGTACATTTGCCCTGCCGTCGGAGCTGGAACGTAGTTATCAGCGCTTCACAGCTTTTTATGCTAGCCGTCACAGTGGCCGAAAGTTGACATGGTTATATCAGCTGTCTAAAGGAGAATTGGTAACAAACTGCTTCAAAAACAGATACACTTTGCAGGCATCCACGTTCCAGATGGCGATCCTGCTGCAGTACAACACAGAAGACGCGTACGCCGTGCAGCAGTTGGCGGACAGCACTCAGATCAAAATGGACATTTTGGCACAAGTCCTACAGATTTTATTGAAGTCGAAGTTATTGGTCTTGGAAGATGAAAATGCAAACGTCGATGAGGTGGAACTGAAGCCAGACACCTTGATAAAATTGTATCTTGGTTATAAAAATAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACTGAACAGAAGCAGGAACAAGAAACCACACATAAAAATATTGAGGAAGATCGCAAACTCCTGATTCAGGCAGCTATTGTGAGAATTATGAAAATGAGGAAAGTTCTGAAACACCAGCAGTTACTTGGAGAAGTGCTCACGCAGCTGTCCTCGCGGTTCAAGCCTCGGGTCCCAGTAATTAAGAAATGCATTGACATTCTGATCGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCCAGAAGTGTCTGACTGTGCGACCCTCCACACATAGTTCCCGGTGGAAAGGATGAAAACTCGAGCTCATAGCAGCCAGTCTGCCGCCATTTGAACCTCCCTTTTTAAAACTGAGACCAAGACTCCCATCAGCCAGTCTCAGATGTACATCAGAACTGCTCAGGATTGATACATTTCAAGTCTGTAAATATAGACACCGACGCCATTTAACCTAATTTAAGAACAGAGGGGAACCGAACCCTCCACGCCGAGGGCTGCATGCTACTGCATTCAAATCGATACGCTGGCTCCGGGGCTCACAGCTGCCGCCTGAGGCAGCACTTACAGTGTTGGCAGCACTTTGAAAGCGAGTCTGAATGGACCCACGTGTAATCTGCTATGAAAACCCATTTGTATAGTGTGTTTCATTTTTTAATGTGTGAAAATAAAGAAAATTAAAGGATTTCTGTACAAGTTGCATTTGGTTTTGTTTTCAGTTTTACTAATTTCTATATGTAAATAAAAGATA