Transcript asmbl_18504

Sequence
Transcript Sequence for observation asmbl_18504 of TGE0072147:
GCTTTGGCAGACGTGGCACCGGGAACTCGGAGGCGGGGAGCGGCTGTAAGTGGCGGTGGCATTTGGACCCGGCGGAGCTGCAGGCGCGGGAGCCCGAGTGGAGACCGGAGCCCGCGGTGGGCAGCGGCAGCGGGGATGGCGCGGGCAGGGCCGGCGTGGCTGCTGCTGCTGGCGATCTGGGTGGTCCTGCCAGTGTGGCTGTCCTCCACAAAAGTCTCCTCGCTCATCGAGAGGATCTCTGACCCTAAAGACTTGAAAAAACTTCTCAGGACCCGGAATAATGTACTGGTGCTTTACTCCAAATCTGAGGCTGCAGCTGAAAGTCATCTCAGGTTATTGTCCACTGTGGCCCAAGCAGTGAAAGGACAAGGCACCATCTGCTGGGTAGACTGTGGTGATGCAGAGAGTAGAAAATTGTGCAAGAAGATGAAAGTTGACCTGAGCCCAAAGGACAAAAAGGTTGAATTATTCCATTATCAGGATGGTGCATTTCATACTGAATATAACCGAGCTGTGACATTTAAGTCAATAGTGGCCTTTCTGAAGGATCCCAAAGGGCCCCCACTGTGGGAAGAAGATCCTGGAGCCAAAGATGTTGTCCACATTGACAGTGAAAAGGACTTCAGACGGCTCCTGAAGAAGGAAGAGAAGCCGCTCCTGATGATGTTTTATGCCCCCTGGTGCAGCATGTGCAAGAGGATAATGCCGCATTTCCAGAAGGCTGCGACCCAGCTGCGAGGCCACTTTGTACTGGCTGGGATGAACATCTACCCGTCGGAATTTGAAAACATCAAGGAGGAGTACAATGTGCGTGGCTACCCCACCATCTGCTACTTCGAGAAAGGACGGTTTCTGTTCCAGTATGATAACTATGGGTCCACAGCCGAGGACATCATGGAGTGGCTGAAGAAGGTGTGGACACTGTAAGAAAATGAAGCCAGAGTTTGAGAGTGCAGCGGAAGTCCTCCACGGAGAAGCAGGAAGCTCTGGTGTCCTTGCAGCTGTCGATGCCACTGTCAACAAGGCCCTGGCAGAAAGATTCCACATCTCTGAGTTTCCTACATTGAAGTATTTTAAGAATGGAGAAAAATATGCAGTGCCTGTGCTCAGAACAAAGAAGAACTTTATTGAATGGATGCGAAACCCTGAGGCCCCCCCACCCCCAGAGCCCACCTGGGAAGAGCAGCAGACCAGCGTGTTGCATCTGGTGGGGGACAACTTCCGGGAGACACTGAAGAAGAAGAAACACACCTTGGTCATGTTCTATGCCCCTTGGTGCCCACACTGTAAGAAGGTTATTCCACACTTTACTGCTACTGCTGACATCTTCAAAGATGACCGCAAGATCGCCTGTGCTGCTGTGGACTGTGTCAAAGATAATAACCAGGACCTGTGTCAGCAGGAGGCCATCAAGGGCTACCCCACTTTCCACTACTACCACTATGGGAAGTTTGTAGAAAAATATGACAGCGATCGGACGGAATTGGGATTTACCAATTTTATTCGAACCCTCCGGGAGGGAGACTACGAGAGACTAGGGAAGAAGAAGGAAGAGTTGTAATTTCTGCCTCAGAGAAAGCTTTTCCATTACACTGTGAATGATACCTGTTTGGTTGTTCTTTCTGAATTTCCAAGTGTCTGGAGACAAAGTTTTTTATAGCCGCTTATGGCCATTTTGTACAATTTTGAAATAAAATTAAACCAATTGTTTGGTGGTGTGGGTTATGTTCATGG