Transcript asmbl_1840

Sequence
Transcript Sequence for observation asmbl_1840 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAACCTGCCCAGCGAGAGCAAACGCTGCGAATCCCAGTCACATTTCCTCTCCTTTTAAGAAAACTAAGCTAAGGTTTTCTCTCTGTAGAGTTCCGTTCCTTAGGGGTTTCGTTCCGTCTTTTTAAGAGTGTTCCAGGGGAGTCTCAAGCTTCTCTGTGGGGCCCTAATGCCCCCTCCCCCTGTGTCCCCTTGCTGTCCCCTGGGCGTCCAGCCTTCTAGTCCATCACGTTGGGGCTGCGGGGGGCAGACTGGCCTTTACCTGACACTCCCACCACGGCTCTGCCTCTGAGGCTGCTCAGTGGTCCCTGTCCTCTGCGGAAGGTCATAGGTCGTGGTGCCCAGCATCCTGCCTGTCTGGAGCCAGTGCTGTCACATCACCTCAGGTCTGTGTGACGTGGGACATCCCTGCCCTCATGGCCACCTATCAGGTGTCCTCTTCACTGCTCGGGCAAGTCCCTGTGCTGGGGGTGGTCTGGTTGACCATCTCAGAGCGGGAGTCCTGTGACAGCCCCTTCCCCGTCAGCCCGTGGCCATGCAGAAACGCCCTCCCCCCCGGGCCCACAGCCTTACTGTCCACAGCACCCTGACTCCGGTACCTGCCCCCTGCCTGCTCACCAATAAAGGCTACCCCACCTCGTC