Transcript asmbl_57384

Sequence
Transcript Sequence for observation asmbl_57384 of TGE0006434:
CTCGCCGCGTCGCCGGTCCCTGAGCCGCCCGCACCTCCTCGCCTCTCCTCTCCCGGCCGAAGCCCGGGGGACCAGAGCGAGAAGCGGGGACTATGTTCCGACGCAAGCTGACGGCCCTCGACTACCACAACCCTGCCGGCTTCAACTATAAAGATGAAACAGAATTTAGAAACTTTATTGTTTGGCTTGAAGACCAGAAAATCAGACACTACAAGATTGAAGACAGAGGTAATTTAAGAAACATCCACAGCAGTGACTGGCCCAAGTTCTTTGAAAAGTATCTCAGAGATGTTAATTGTCCTTTCAAGATTCAAGATCGACAAGAAGCAATTGACTGGCTTCTTGGTTTAGCTGTTAGACTTGAATATGGAGATAATGCTGAAAAATATAAGGACTTGGTACCTGATAATACTAAAAATGCTGACAAAGCAGCTAAAAATGCAGAGCCACTGATCAATTTGGATGTAAATAATCCTGATTTTAAGGCTGGTGTCATGGCTTTGGCTAACCTTCTTCAGATTCAGCGTCATGATGATTACCTGGTGATGCTTAAGGCAATTCGCATTTTGGTCCAGGAGCGCCTGACACAGGATGCAGTTGCTAAAGCAAATCAAACAAAAGAGGGCTTGCCTGTTGCTTTAGACAAGCATATTCTTGGTTTTGACACAGGAGATGCAGTTCTTAATGAAGCTGCTCAAATTCTGCGATTGCTGCACATAGAAGAGCTCAGAGAGCTACAGACAAAAATTAATGAAGCCATAGTAGCTGTTCAGGCAATTATTGCTGATCCAAAGACAGACCACAGACTGGGGAAAGTTGGAAGATGAACATTTTAGGATGTTAGCCGCTCACCTACTTAGTACAGTTGGGAACCATGTATGCTGTGGCATGTGTTTGGGAATCAAATGTCAATTTTCAAGGAAAGGATCCCAGAAAATTGACTATGTTCTAGAGATTTATCATCATTGCTTTTTCTTTAATAAAGTTCAGGAATGTAGA