Transcript asmbl_182236

Sequence
Transcript Sequence for observation asmbl_182236 of TGE0006102:
CTAGAGCCATACATTTATTCTCAAGTGCATACCAAAGATAAAAATTAGGGTAAAAATGCAAATTCTCTCTGTCGTCCAAATAAGAAGTTAATCATTGCCTCCGGGCTTCAGAATTTAACTCTCCTCCACCCCCTGCAAAGTGCAGTTTTCACATTGCTTAGGGCAAGGACAAGCCTGACCAAACTGACTTGCAGGTCTTTTCAATAACTGGTCTTTTCAGTCCCCAGTGTCTGTGAGGAAAGGGGAGACGGCCGTTTGTCAGAACCTCCGTGCTGTTATTCTTCCTGCGTTCGACTCCTGACTTGGCTTTTATGCCATTGTTTATCCCCTCTTCTGTACTTGGATCCCTCGGGGTGTGTGTTTCCAGGAACAAGAGTGTATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAACTGTTCCAACAGAGTTTTTAAGCCCACCCGACTACCCGAGCTCTTCCTCTTCAGCGTCTCTAAATATTGAAAAAGAGACCAGCCCTCTAGGAGATGACAGACTTGGCGACACCGTCTAGGACACTCACCGATGGGTCCGAGAGGGAAAAGTGTACCCACCTATCTTCCATCTGTAGAAGTCTGGCTTGATCATCCGAGCCTTCTATGAAAGTTGAAACGTGTACCACGTTCACTAATTTTCAGCTTTGCCTTTGGAAGCAGAAATGAATTTTGTCACATTTCATTGCATGGGAACTTAGACTTGTAGTTAGAGAAAGTTCAGCAAGTAGCAGATATGTATATAAGCAATAAAAGAATGATTTCAGAAA