Transcript asmbl_182233

Sequence
Transcript Sequence for observation asmbl_182233 of TGE0006098:
TTGGGGAGTTGGGGGGTCAGTCCAGGCAGGTCTGACTTGGAGCCTGAGAGAGGAGAAGGTGTTTGCAGAAGGGCAGCGGCGTTTCAAGCAAAGGGCGCCTCTGGGTGGAGGAGGCGTGGGCGCTGGAGAAGGGCGTGCTCGGGCGAGCAGCACTCGCGGCGCCGCAGGACATGAATGCAGTCCAAGTCCTGGGGGTGCCCGGGGGGCATCGTAGCGAAATTGCCTTGCTGGTCCATTGGGAGCGCGTCCAGAACCCCAGGCTTAGCTCTCTTTGCAACACCCAGCCAGGTCCCCACCGGGCACCTGGCCGCGCTCGGCTGTCCGGTCGCGGGCATGCTGCCTTGAGCCGCTGACCCCGCTGGAGACCCTGCATGCCAGCCTGGCCTGAAAACGGAGGACTCCACAGACCCGGTCCTCCCCACACCTCTTCTGCACAGAAGCAAACCCTCCTGACTTAGCCACGGCTTCCAGAACCTCTGAGACGGGAGGCCCCCAGGTTTACCTCATGTTTGGGGCATCTTGCTAGCTATGGCCCTGATCCTAGGCTTCTTGCTGCTGCTGGGGCTGGGCGGGAATACCATTTCAGAGGAGCCGCTGTCATCCAAAAGGACTACTTCTGATGTTCTGGAGTTTAAACTCCGGGAAGTGAAGTATGAGACCGAAGACTCTTATAAACTTGGACCCATTGGCATTCTCTTTCAAGTAGTGCACGTCTTTCTCCACGTGGTGCAGCCCAATGCTTTCCCCGAGGATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAGTAAGCCTTTTCTTTTTTAAACCGTATTCATAAGCTCAGATGGGGGGGAGGCTCTTTATTATTATATGATGGACTTTTTAAATTAAGAACATCTTAAAATGAGGTAACGACAGTAGGCGTGCCCAGATTAAAATAAATGCTGATGTCTGTTGAAATAAGGACTGGTAAATAAGGACTGGGCGTTGAAGAAGTATTTGTCGAATTAATGAAAATTTTGTGTGTTAAATTTATGAATATACAAAAGGGTTGTTTTGAGATTTGATCTTTAAAGGGAGCAACATGTAAATATGCCCTTTGGCCTTTTTTTGTGTATTTGACAAGGCGTCAGATATTTTTCATGACTCTTACATTGTCTTTGTCATCCACGATATCGATACTTTGTCTTAGTAATAACATGGTGTTTGTGATGTATTTGTTTTTGTCACAGTATGCAAAAGGGTAATGTTGATTTTAATAGCCATCAAACCGCTCAGACTGTTCCAACAGAGTTTTTAAGCCCACCCGACTACCCGAGCTCTTCCTCTTCAGCGTCTCTAAATATTGAAAAAGAGACCAGCCCTCTAGGAGATGACAGACTTGGCGACACCGTCTAGGACACTCACCGATGGGTCCGAGAGGGAAAAGTGTACCCACCTATCTTCCATCTGTAGAAGTCTGGCTTGATCATCCGAGCCTTCTATGAAAGTTGAAACGTGTACCACGTTCACTAATTTTCAGCTTTGCCTTTGGAAGCAGAAATGAATTTTGTCACATTTCATTGCATGGGAACTTAGACTTGTAGTTAGAGAAAGTTCAGCAAGTAGCAGATATGTATATAAGCAATAAAAGAATGATTTCAGAAA