Transcript asmbl_57378

Sequence
Transcript Sequence for observation asmbl_57378 of TGE0010293:
AGCCGCAGCTGCAGCTCTGCAGAGCAAGGCTGGGGGCTGGGGCCGGGGCGCCCTCCCTCCCACCTTTTCCCGCCGCTATGAGCCAGGGAAGTTCGGGGGACTGGGCCCCACTCGAGCCCACCTCCGGACCCCCAGCGCCCCCCAATCCCTTCGTACATGAGTTACGTCTCTCCCGCCTCCAGAGGGTTAAGTTCTGCCTCCTGGGGGCACTGCTGGCCCCCATCCGAGTGCTTCTGGCCTTTATCGTCCTCTTTCTCCTCTGGCCCTTTGCCTGGCTGCAAGTAGCTGGTCTTACTGAGGAGCAGCTTCAGGAGCCACTTACGGGATGGAGAAAGACCGTGTGCCACAATGGGGTGCTGGGCCTCAGCCGCGTGCTCTTTTTCCTGCTGGGCTTCCTCCGGATTCGTGTTCGAGGCCAGCGCGCCTCTCGCCTTCAAGCCCCTGTCCTTGTTGCGGCCCCCCACTCTACTTTCTTTGACCCCATTGTTCTGCTTCCCTGTGACCTGCCCAAGGTCGTGTCCCGAGCTGAGAACCTTTCTGTGCCTGTCATTGGAGCCCTTCTTCGCTTCAACCAAGCCATCCTCGTATCCCGCCATGACCCAGCTTCTCGGCGCAGAGTGGTGGAGGAGGTCCGAAGGCGGGCTACCTCAGGAGGCAAGTGGCCCCAGGTACTGTTCTTTCCTGAAGGCACCTGTTCCAACAAGAAGGCTTTGCTTAAATTCAAACCAGGAGCCTTCATCGCAGGAGTCCCTGTGCAGCCTGTCCTCATCCGCTACCCCAACAGTCTGGACACCACCAGCTGGGCATGGAGGGGCCCTGGAGTACTCAAAGTCCTCTGGCTCACAGCCTCTCAGCCCTGCAGCATTGTGGATGTGGAGTTCCTCCCTGTGTACCACCCCAGCCCAGAAGAGAGCAGGGACCCCACCCTGTATGCCAACAATGTCCAGAGGGTTATGGCACAGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGTAAAGGAGCTGGAACGCAGAATGCAGCGCTCAGGATTTAAGGATGGTATCCCCACAGCCATGTCAGTCTCAGTGGATGGCCAAT