Transcript asmbl_182161

Sequence
Transcript Sequence for observation asmbl_182161 of TGE0006087:
TCCGTCTGGTCGTTTCCTCTGACCTCACAGCCTCCGCGCCACAACATTGAGGAAAGACCCCGAAGTCCGGCGTCTTGCCCTTTGCCCAACCTGGCTACAAAATGTTGCGACAGAGGACGAGGTACAGGAGACTGGCGTTATTGACTGAAGGAATGGAAGACGGGAAGCGTGGTGCGGCTGCGAATAGAAAGGGTGACAGGTGACATAGTTGGAGTTGAATCTGTGGAGCGCTCAGGCGTTTGGTGCGGACACCTCGCGGAGTCCTTTCTCACTGCCGTCTTGTGCGGGAGGCTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAAACACTACGTTTTTACCTATGATTTTTGATCCTTTAAAATGTAGGGAGGAAATGGCCTATGTTTTGTGATGATTTATTTTTTAGCAAGGATGTTGGTTAGCAGTTTGTTTTTCCTTTATACAGTTTTAGATGAACTTGATTCATATTTAGTTTCTTATTTGTAGGCACATGACACATGAAATTTCAGCCCTTGGGTTTTTAGTATATTGTGTATCTGTGTTATAAATCTCTCTCCCTTTTCAAAAATGATGAGTTGGAATTTTTGTAAGGTTTATCAACTAGTCACATTGTAATAATATTAAAAATGAACAATTTGATTCTTGAGAGCCAAGCATCATAAAATCTAGGAGATGTGGCATTTGAACATTATTGTTATTGCTTGCCAAAATAACCCAGACTTGTATTTTTCAGGCAACTTTTTTGAAAGACTGAAATTTCCAACTGTGTATTGAACTTTACTTTCCATTTAGCGAAGTAATTAGTAATAAATTTTTCGTGACTCTGAAGCATAAACACATTGCAAAGTGTTGCCAGTGGAGCTTCCAATAAATGGACCATAAAAGCAGCAGTCTGTTTTTTCATTCTAGCTTACTTTAAAGATTGTGGGGTAC