Transcript asmbl_181432

Sequence
Transcript Sequence for observation asmbl_181432 of TGE0006078:
GGCTGAGAGGCACGCGCGGCAGGGAGGGGAGGGGCGTACGCAGAGCCGCTGTAGTCTCGCGCGGCGGTTGCGAGCGCGTGAGGGACCTGTGCTGCGTTGCGTGCGGTTAGGCAGCAGCGGCAGCAGGAGCAGCAGCAGCTGTGTATAGGAGTCATGAAACACCACGAGGTGGAGATTCTGGACGCGAAGACACGGGAGAAGCTGTGCTTCTTGGACAAGGTGGAGCCCCATGCCACCATCGCCGAGATCAAGAATCTTTTCACTAAGAGCCATCCGCAGTGGTACCCTGCCCGCCAGTCCCTCCGTCTGGACCCTAAGGGCAAGTCCCTGAAGGATGAGGATATTCTGCAGAAGCTGCCTGTGGGTACCACGGCCACACTTTACTTCCGAGACCTGGGGGCCCAGATCAGCTGGGTGACGGTGTTCCTGACAGAGTACGCGGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTGCCCTTCATCTATGGCCACAAATATGACTTCACGTCCAGCCGGCACACGGTGGTGCACCTCGCTTGCATCTGCCACTCATTCCACTACATCAAGCGCCTTCTGGAGACACTCTTCGTGCATCGCTTCTCTCATGGCACCATGCCCTTGCGCAACATCTTCAAGAACTGCACCTACTACTGGGGCTTCGCTGCGTGGATGGCCTATTACATCAACCACCCTCTCTACACGCCCCCCACCTATGGAGCTCAGCAGGTTAAACTGGCACTTGCCATCTTTGTGATTTGTCAGCTGGGCAATTTCTCCATCCACATGGCCCTGCGGGACCTGCGGCCAGCAGGGTCCAAGACCAGGAAGATCCCCTACCCCACTAAGAACCCCTTCACATGGCTTTTCCTGCTGGTGTCCTGCCCCAACTACACCTATGAGGTGGGGTCCTGGATTGGCTTTGCCATCATGACACAGTGTCTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAGCACCGCAGCTACCTGAAGGAATTCCGAGACTACCCACCCCTGCGCATGCCCATCATCCCCTTCCTGCTCTGAGCTGCCCACCCCACTGGCTAGGCTCCGCCAGGCTTTCATCCCCCCACCCCTTGTCCTTTTGGGAGAGAAGTGAGGACCACTGCTCTTCAGCGCATGGAATAAAACCTGCCTGCATAGCCGGA