Transcript asmbl_181347

Sequence
Transcript Sequence for observation asmbl_181347 of TGE0006056:
GTGAAAGAGTTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGGAAAATCCTGCTCAGAATACAGCCCATTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACAGGCTCCTTCGGGCGGGTGATGCTAGTAAAACACAAGGAGACCGGGAGCCACTTCGCCATGAAGATCCTGGACAAACAGAAGGTGGTAAAGCTGAAACAGATCGAGCACACCCTGAACGAGAAGCGCATCCTGCAGGCAGTCAACTTTCCGTTCCTCGTTAGACTCGAGTTCTCCTTCAAGGACAACTCAAATTTATACATGATCATGGAGTATGTGCCTGGCGGGGAAATGTTCTCACACCTGCGGCGGATCGGAAGGTTCAGCGAGCCCCATGCCCGCTTCTACGCCGCCCAGATCGTCCTGACCTTCGAGTACCTGCACTCCCTTGATCTCATCTACCGGGACCTGAAGCCGGAGAACCTTCTCATCGACCAGCAGGGCTACATTCAGGTTACAGACTTTGGTTTTGCCAAGCGTGTGAAAGGCCGCACCTGGACCTTGTGTGGGACCCCTGAGTACCTGGCCCCTGAGATCATACTGAGCAAAGGCTACAACAAGGCTGTGGACTGGTGGGCACTGGGGGTTCTCATCTATGAGATGGCCGCCGGCTACCCACCCTTCTTCGCTGACCAGCCCATCCAGATCTATGAGAAGATTGTCTCTGGGAAGGTGCGGTTCCCGTCTCACTTCAGCTCTGACCTGAAGGATCTGCTGCGGAACCTACTGCAGGTGGACCTCACCAAGCGCTTTGGGAACCTCAAGAATGGGGTCAATGACATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATCGCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGAGATTCGAGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAGGGGTGTGCCTGTGCCCCCAAGGGTTTTTTCTTTTTTTGTGTGGGGGGGGTGGGTGGGAGGGTTGGATTGAACAGCCAGAGGGCCCCAGAGTTCCTTGCATCTAATTTCACACCCACCCCACCCTCCAGGGTAGGGGGAGCAGTAAGACCAGATATTCAGAGGGACAGAAACACCAGCTGCTCCCCCTCACCCCTTTCGCCCTCCTGCCTCCCTACTGCTTTTGCCTTCCCCTATCCTTATGGCCCCCCACCCCAGCCCACTTCTGCCTATTTTAAATAAGTTCTCAGTTCTAGTCAGGCCAGGTCTTGCTAGTGTATCCAGGGACAGGGTGTGGAAAGAGGGGCCGGAACTTAACTCCAGCCCCCACTTCCACCTCCCTCACCAAACCACAGGCACCACCTGCTAAGGGAGAATGAAAGAATGGCCAACCTTCCCTTCAGAGCAATCCTACCCGGGAAGGAGAGATTTTAGTGACATACCAGTGGGTTGCTTGCTAGAGTTTTTTAAAAAGCAATTTACAATCTTATTTACAAACTTATTTAAGTTCCACCAGTGCCTCCCTCCCACCTTCCTAAAGCCCCCTCCCATGCCCCCTCCTCAAATCCATTTTAACAAGGCTGGGAAGCAGACTGACTTATAAAGGAAGGAACTGGGGTTCCAACCTCCCCTCCAAGCTGCTAATCTCCCCTGTCCCCCACTCCTGGGGTCCCCTGCCAAGCCTGGAAGGGTCTTAGCCCCTGAAGCCTATTCCCTTCTGCCCCAACAGACCTTTTGTCACCCTTGGGCTTTGGGACCCAGACAAAGCAGCTGCCCCCCTCCCTGCCAAAGAGGAGTTGTCCCCCAAAATGATAGAGTGGGAGCCCCAAGCCCAGGGTCTTTCCTCCCAGCAGCACTCCCCCCAAAACTCCTTAATTTTATTCTCAGCTAGATTTTAATGCCCAGCCTCCTCTCAGCTCAGTTGGGAAGGCATCCCCCGCAAAAGGAGGCAAAGCCCCCCTCCCCCTCCTGGCCCCGGTTCAAGGCCAGGGTCGCTGGGGAAGGGCTGCCAGTTTTATTCACTGAACTATCTCCGCCCCCCATCCTGGGCGCTCCTCCTATTAGCTGTCAGCTGTCCATCACCCCTCCCCTAATTTGTGCTTCTTTTTCTCTGAATAGAAGTGGGGAGCCCAAATCTGTCCCTCTCATAACTTCTCCCTATCCCAGGAGGAGCTCTCAGGCCTGGGGTGGGGCCCCGGGTGGGCACGGGGGCGATTCAACCTGTGTGCTGCGAAGGACGCGACTTCCTCTCGAACAGTGTGCTGTTGTAAACATATTTGAAAACTATTACCAATAAAGTTTTGT