Transcript asmbl_179204

Sequence
Transcript Sequence for observation asmbl_179204 of TGE0006025:
GGAAACAAAGGCAGCCAATCAGTGCGGCGGCTTCCGCTACGCCCTGACAACAGCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGACTTGTTGAGCATCTACTATTGGCTACACTGTTCTAGTTGCAGACAGTATACAGCATGAACAAAATAAAAACCCTTGCTCTCATGGAACTTCTATTATAAAAAAATAGTGAGGTAGTCAAAAACTGAATTACTATACCTTGGATATGCAAAAAAAAAATATTATGGATTCTTCTTTTCTGTAATTGGTCTAACTCTAATGCACCTACCCTCCTAGATAATTAACAGACTTGGAGTATGTAACATGCAAAGGAAGGTACAGTCAGTCCTCATTCATGGATTTTGTATTTGCGAATTTGCCTACTTGCTAAAATTTATTTGTAACCCCCAAATCAATACTCACAATGCTTTGACAGTTATTCAGAGTGGCAAAAAATTTGAATCACTGGATACGCACATTCCCAACTGAGGCCGAAACAAGAAGGCAGCGCTCTGCCTTCTTGTTTCAGCTGTTGTATTGTAAACCAGTGTCCTTGTTGTGGTATATTTAGTACCACTTTTTCATATTTTTGTGCTTCTCATTGGTTATTATTTTGTTGGTTATTAAAATGCCCCTCCCCCCAAACGTAGTGCTGAAGTGCTGTCTGGTGGTTCCTAAGCACAAAAAGGCTGTGATGTGCCTTATGATGAAAATAGATATGTTAGATAAGCCTCATTCCAGCATGAATTATAGTGCTGTTAGTTGTGAGTGCAGTGTTAATCAACAACATATATTAAATAAAGTATCTTTAAACAGAAGCATACAGAAAATAAAGTTATGTATTAATAGTTGAAAATATTGTGATCAGAGGCACGCAGGAACCTAACCCTGTATTTCCCTGGGAGAAATGCTTTGGTGTTCATTAATCCATTGTTTGTGGTAACATTACAGAACATAATGACCATGAATAATGAGAATCCACTGTATTTCCATCTCTTGCAATTTAAATGTTTTCAGGTTAGTTCAGCCTCTAATAAATATTTAATTAATTCAAAATTACAATCCACTTCCTCTACATTCTCCCCAACATGATATCATGGTGTCGGGACAGTGTTTGTGTCCCTCATTGTGGTGGGGCAGCTGTTCCAAAGGAAGGTCCTCTGGCTCCCTACTTGACCTCTGTCAAGATGTCCACTGGCCACCCTATTGGCCATCTCCCACCAAGTGTAAGACTGGTGAGTCTCATGTGCTCTCCCCATGAAACTAGTGATCCCTAGGCTGACTTGGCCCCATCCTGGCTGGGGCTGGCCCTGCACATCTCTGAGAGCCATCTGTGTCTCTCATCCATCTCAAGTTTCTTTGTAGCTGTATGGCAGGATCACTTTACCCTTTGCCACAGCTGGCCTGTCCAATTCATTCTCTATGTTCTGCTTACTGGGAGAAAAGCATGATTTGGGGAGGAATTGAGAACATGGCAGATGAATATTTTCAAAATATTATCCTCATTACAACAGTAAGCAATGCAGTTATGTTTTCATTATAAACTGACAGGAGGGTTTACCTGATCATGCAGAATATTTTTTAAATTTTAACAATACTGTTGTCCTTTTTAATTGTGAAATATAAATAACATAAAGTTTACCATTTTAGCCATTTTAAGTGTGCATTCTGTGTCATTAAGTACATTCATATTATTGTGCAACCATCACCACCATCCA