Transcript asmbl_178873

Sequence
Transcript Sequence for observation asmbl_178873 of TGE0005978:
GGTCTTTTCCTTTGTGCTGTCAGCTATGAGTTGGTTTAGTGAGTAGTTTTGCAAGACTTGTTTCACTTTGTTTTGGACAAGGCTGAGACTCATATTTCAAACAAAAGGCAGCCAATTACTAACATCTGGTTGCTGGGTGTGGTCTCCTTTCAAATTCTATAAAATCTGAAGCCCAAGGCTTCACTTCCAGTGTGAAACAGTCGGAGAAGAATCTCTCTTTAGCTTCTGAAAAGAAGGTGGAAAAAAAGAAACTTCTTCAAAAATGTCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATACGTTAAAACTGTGAAAGCATCCAAAGGTGGTCCTGGGTCAGCAGTGAGCCCCTATCCTAGCTTCAATCCATCCTCAGATGTCGATGCCTTGCATAAAGCAATCATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGAGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAAAAGGAAAGCCCCTGGATGAAGTTCTGAAGAAAGCCCTGACAGGTCACCTTGAAGAAGTTGCTTTGGCTCTATTAAAAACTCCAGCCCGGTTTGATGCTGATGAACTGCGTGCTGCCATGAAGGGCCTTGGAACAGATGAAGAGACTCTGGATGAAATTTTGGCATCAAGAACTAACAGAGAAATCAGAGAAATTAACAGAGTCTATAGAGAAGAATTGAAGAGAGATCTGGCTAAAGACATCACCTCAGACACATCTGGAGATTATCAGAAGGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGATATTGGCATAAATGAGGACTTGGCTGATTCAGATGCCAGGGCATTATATGAAGCAGGAGAAAGGAGAAAAGGGACAGATGTGAATGTGTTCACTACCATTCTTACCACCAGAAGCTACCCCCATCTTCGCAGAGTGTTTCAGAAGTACACCAAATACAGTCAGCATGACATGAACAAAGTTCTGGATCTGGAGATGAAAGGTGATATTGAGAAGTGCTTCACAACCATCGTGAAGTGTGCCACTAACAAACCAATGTTCTTTGCTGAGAAGCTTCATCAGGCCATGAAGGGTGCTGGAACGCGTCATAAGGCATTGATCAGAATTATGGTTTCCCGTTCTGAAATCGACATGAACGATATCAAAGCCTGCTATCAGAAGTTGTATGGTATCTCTCTCTGCCAAGCCATTCTGGATGAAACCAAAGGAGATTATGAAAAAATCCTGGTGGCTCTCTGCGGAGGACAGTAAATATTCCTTTAATGATCTCAAGCTTTTTGATCAGAAGATTTTTTAATCATATCTTTTCATTCCATATTACAGACTTAAATAGAAAAGTTTGTTCAGCAGAATTAGTTAGCTAACTGCTTTCTGAAAACTATGGCTTATAAATCATTTTTATATCATAACTCTGTATAATAGAGATAAGTTTTTTAAAAATTTATTTACCCCAATTATAAAACCCCACGAACAGGTTGTTCTAGTACCATTACTTGAGAAAGATGTTTATGTAACAGAAAATAAAATGATTTTACAGGACAATTGGTGTGTCATTGGTTCTTCTATTCTGATTTTTTTCTATGTGTAATGTAGTGGTTTAATTTGATATAAGGAGATAGGAACTTGAATTCTAAATTATAATTATTTAATGAAATAAATATTACATAGTAAATTAAAGTATTCACAGAGGTAGAAAATGGACTCCTTAAATTTTATCATCTTAGTACAGATTGCTGAGACTGTCTCTGTATAATAATGAATTTATTGAATCAGCATTGTAACAATTGGACATTCTGCTACATTTCACAAATCAGTATAAAAATGAAATGGTAATGACAATAAAAATTCCCCACTTTTAAAAAAATGGTAGTAGCATATTTTCTAAGAAACTCTCAAACTGTTTTCCAGAGTGGCCATACCATTTTACTTTTCATGATAAATTCACGAGTGATCTAGTTTCTCCACAACTTTGCCCACATTTGGTATTGTCACTTTTTCTGTATTTTAGCATTGTTTATTTTATATTGTTGAGTTTTGAAAATTCTTTACATATTCTAGATACTAGTGTTTTGTCAAATATGTGATCTGCAATATTTTCTCTCTATAGCTTGTCTTTTTTTATTCTCTTAATAAAATCTACCTCAGAGCCA