Transcript asmbl_178817

Sequence
Transcript Sequence for observation asmbl_178817 of TGE0072052:
ATTGCAAAGAGGGTGAAGCGGGACCGCCGAAGGGAGCAGACAGAAGCAGAAATTGGTGTGTTAGCCAAGACTTTCATTGAACAAGGGAAGCTCATCCCAGATGATGTCATGACTCGGCTGGCCTTTCATGAGCTGAAAAATCTCACCCAATATAGCTGGCTATTGGATGGTTTTCCAAGGACACTTCCTCAGGCAGAAGCCCTGGATAGAAATTATCAGATAGACACAGTGATTAACTTGAATGTGCCCTTCGAAGTCATTAAGCAGCGCCTTACTGCGCGCTGGATTCATCCAGCCAGTGGCCGAGTCTACAACATGGAGTTCAACCCTCCCAAAACTGTGGGCATTGACGATCTGACCGGAGAGCCTCTTATTCAGCGTGAGGATGATAGACCAGAGACGGTTGTCAAAAGACTGAAGGCTTATGAAACTGAAACAGAGCCTGTCCTGAAATACTACCAGAAAAAAGGGGTATTGGAAACATTCTCTGGAACAGAAACCAACAAGATATGGCCTTATGTATATGCTTTCCTACAAACAAGAGTTCCACAAGTAAACCAAAAAGCATCAGTTACTCCATGAGGAAAAGTATGTATAACTAAAAAGATGAGAAGCTCCTCATCTGAGCATTTGGAAGCTCCTTGTCCTAAGACTCTGACATGTATGAATTCTTTGAAAATGTTAGAATCATTTCTACTGATTTTATTCTGGAAAGTAAGGATGTGCCAAATAAGTCAGATACTGAAATTCATCTTTTGAAATCATCTAGTGTGTTTTATCCAGTTATCTTCTATGAGTGCACAATTCACAAGTATCAGAGATGTCTAATGAAACTTTTGAAAAATTGTTTGGAGAATAATTAAAAGAGCAATTGGTAGTAATATAACTTTTGTTCAGAAGAGTAAGTGGTTTATAAAATTTCTGTATTTTTCGGGAAAAAAAATTCCGTCATTTGAGAAAAGTATCTCATCAGAGGCTTTGGCTTAGACTGATGCTGAAAAAACATCTCTAGCACTGTGACACATGGTTTTGTGAGACACTATGTCTATAAAATTCCAGAATAAAAGCAACTGGATTTAAGATTTTTAGGATGCAAATTCACTACTGCCTCTCCACTAAGAAATTTATAAGCTAGTCATATATGTTGTATTTATTGTTGTTAAGCATACCTTCAGGTTACTCAGAATTTTCAATTTGCTATAAAACTGTATCAATTAACAGATAAGAAAGTATTAATTTCCTATGACTTGTTTTCTTTTGAAAATACATGTGTACTGAGGGATACGATTTATGTTAGAAATGGACATTATACGTTCTTGGAAAAGCACTAAAGTTGAATTTTCAACGGAAAATGTAAAGACCTATGTTTTCAGATGTTACTTAGGTTAAGAGATATGCTTTAGGATCTACTTGTCAGTTTCTCTTTCTGATCAAAATGTGTGATCTACCTTGAGGAATAGCATATGAAAGTACACGCACACACAAAGAAAAGAAAATCTATGGCACTAGGTAAAGTAAGCATGCTGTGTCATTAGGAAATAGAAATAGATCATGTTTGCCTGGATAAAATTCTCTTGACAAATGTAACAATCATAATTAGTAAACAGGTATGGCAATGAAAAAGATTTATATGACAGGTTAAAAAGGACCAGGAAACTAGTTTGCTGAAGGAGTTTATTCCTAATCAAAGAAATTGACACTGGCTAGCATTCACTGTCATCATATCTTAAGGGTAAAGAACTCTGCTGGTAAATGTAACCTGAGCAGCCATTTTAAAATCAAAATGATTTGATTTCTTAGTGGGGCAACAGGGATGCATGCTTATGTACTATGGCCTGGTAAAAAGATTGAGAGGCAAAGAAACCTGACTATATATTCAGTGGCATATTTACTTTTACTTTACTTGGTGCCAAATCAAATGAAACAAGTCCCTGTACAAGTTATTATTAACTGCCTTTGAAAATTTTGCCCGTTTTATTCTAGGCACTTAAAATACAAATGCCAGTAAACGATTCTTATGTATCACTTTGTGGGGGGAAAAAACCTTATTTTCCTTTCTTTTTATTTTTTAAAATTCAATATTGATCTTTCAAATCGGACCAAGGCTTTTAAAAAGGATTATAGTAAACATTCCACTCTTTACAAAACTTTCTATAATGCGTTAATCGAATGTCAATATTGTGTGTTTTCTAAAAATGTCGTGTACTAAAGAATTACCTCTGTGTTAACAGGCATACATCAGTATTAAGGTATTAGAATACAGGTCAATTTTAGAACTGTAGATATTATTTTCTCTTTGGTAGTCACAGGGCCCACCCCATCCGACCTTTTGTCCTGCTGCCCTGAAGTCTTACTAGTTTCTGAATTAGGAACTGATTTCTAATTGTTTAAAAAGGGTACACAGGCTGGCTTCTATTTATGCTACACTTTATCTCCTGCTGTAGTAATGCAGCTATACTGGCCTTCTTGACACCCTTAGGACATCTGAAAATCAAAAATGGGTAGAAGAACATGGCTCCTAAGACTCTTCTTCCCTGTGACTATTCTCTCCTCATTCCCAAAACACTTAACCCAAAGTTTTGCACATACATCCATTACTTTGGGAAATGCCTGCACTATTACGTTTTTCCTTCATTAAAGCAAAAAGAATTTGTTTTATGCTTAATGTCATAGGTGGTTCTGATGACCATTATCATAGCTGAGCACATCCTGCAAAAAAACCCATAATGCCATAATGCCTATCATTATGATTTATGTGCCACATGGATATATGTCTGGTGCTTAATGGCATGGCTAGAAGCTACAATGCCTCCAAAGCTAATGAGAACAGTACTTCAACCGATTTCTGTGTTTTCTGGAGTACAGTAATTTTGGTACACCTTTTATAAGCAGAGTGTGCTATGGGAAATGGAAAGTGACAATTAGTACCACCCAGAAATTTTATTTCAAAATTGTATTTGAAATAGGTTAAATACTGGCTCAAATTTCTAAACCCCTGCCCATAGCTACGTTCCCCCAGTTATTTACAACGGCATTCCAGCAAAGTAAATTATTTTGGGTACTCAGTTTGTGACAAAACTTATCTGTTAGTAACAAATCATGGTAATTACAGACCTCAGTTTTAATTGCTGTAATACCTGCAGTCAACAGCAAGAATAAATATGTATTTTAAAACATGCTTATAAGCTGTGTCTTTTCACTGACAAAAGAAAATATTCCCAGGAGCATTTGAGATCTTGCTCCCTGGCATATGTCATCAGTTTTGGCTCAAATAAACTC