Transcript asmbl_178812

Sequence
Transcript Sequence for observation asmbl_178812 of TGE0005972:
GGCCCCTTTAAGGAAGCCAAGGGCTGCGCTGACTGGCTGGGGCGGTCAGCCAATCAACGAGGCGAGGCCCGGTTCCTGCTCCATTCTGCGGTCCCAGAGCTTGAAGGCCTCTGCCACGGTCACCGTGACCCCGCGCCTCTGCCGCCCCCCGGCAGGTCAAGATGGGGTTTATATTTTCAAAAGCTATGAATGAAAACATGAAAAACCAACAGGAGTTTGCGTTAATGAATGCTCGACTTCAGCTAGAAAGGCAGCTAATAATGCAGAATGAAATGAGAGAAAGACAAATGGCCATGCAGATTGCTTGGTCTCGAGAATTCCTCAAATATTTCGGAACATTTTGTAGCCTTGCAGCAATCTCTTTAACAGCTGGAGCAATAAAAAGGAAGAAGCCAGCCTTCCTCTTTCCTCTTGTTCCATTAGGCTTTGTCTTTACCTACCAGTATGATTTAGGCTATGGAACCCTTCTACAAAGAATGAAAGGTGAAGCCGAGAACATACTGGAATCAGAAAAGAGTACATTGCAGTTGCCAAAAGGAATGATTACTTTCGAAAGCCTTGAACAAGCCAGAAAGGAACAAAGTAAATTCTTCATAGACAAATGAAATCATGTTTACCCACCAAATCTCAAAACACAGAATTGTTGACTCGAATCATGGTTTTTACAATTTCTTAAATGCTCGAGATCTTGATGTAATGGATTTTATTTTTAAATTTTAAAAATCAGTTTTGTTAAACTATTTTAAAGTAAAATTTATAACATTCAACAAAAAATGGAGGTTCTCTAAGTAACTTTCAGATTTCCTATATGTGTGTGTGTGTATAATAAATAAATGTGAAATTAATAAACTATGTTGTTTTGAATTCCTG