Transcript asmbl_176758

Sequence
Transcript Sequence for observation asmbl_176758 of TGE0005955:
ATTACGCGCCCGCTCTAGATGAATACCAGAGAATGCCCGGCTTCCTGCAACACGTGACTAGTTAGCCTGGCAGCCCGGCCCCACCGCCTGGTCTGTAGGTAGCGCGATGGACTACGCTTCCAATGGTTTGCGGAACCTCCCGTCACGTGCAGTTTTTGCAAGCCCAGCGGCCTTCCGGAAGGTCATGTGACAGTTGACGTTATTGTGACGCTCCCCAATGGAAATCAAGAGCTACCTTCACAGGACAGGAATTGGTTTCTCTCCACGAATAATAGCCCCGCGGGGGCAGGGATATCCTATCACGTGCTGCGGGATGGATTGGGGCGGGGCAGGCCACTGGTTGCGGGGCGAGCTGGGCGCGAGGCGCGCAGGCGCCTTGGGGACCCGGTAGCGGCGGTGGCAGTGGCTGCGGCGACGGGATCCTTGGCCGAAACTGAAGGCGGTGGTGGCGGCCATGGCGGCCGATGGAGAGCGATCCCCGCTGCTCTCCGAGCCCATCGATGGTGGTGCTGGCGGCAATGGATTAGTGGGACCAGGCGGGAGTGGGGCTGGGCCCGGGGGAGGCCTGACCCCCTCCGCACCACCGTACGGAGCCGGTAAACATACCCCGCCCCAGGCATTTCCCCCATTCCCTGAGGGACATCCAGCCGTGTTGCCTGGGGAGGACCCACCCCCCTACTCACCCTTGACTAGCCCGGACAGTGGGAATGCTCCCATGATCACCTGCCGAGTCTGCCAGTCTCTCATCAACGTGGAAGGCAAGATGCATCAGCATGTAGTCAAATGTGGCGTCTGCAATGAAGCCACTCCAATCAAGAATGCACCCCCAGGGAAAAAATATGTTCGATGCCCTTGTAACTGTCTCCTTATCTGCAAAGTAACTTCCCAGCGGATTGCCTGCCCTCGACCCTACTGCAAAAGAATCATCAACCTGGGGCCTGTGCACCCAGGACCTCTGAGTCCAGAACAACAACCTGTAGGTGTCAGGGTCATCTGTGGACATTGCAAGAATACTTTTCTGTGGACGGAGTTCACAGACCGAACCTTGGCCCGTTGCCCTCACTGCAGGAAAGTGTCATCTATTGGGCGCAGATATCCACGAAAGAGGTGTATCTGCTGCTTCTTGCTTGGCTTACTCTTGGCAGTCACTGCCACTGGCCTTGCCTTTGGGACATGGAAGCATGCACAGCAATATGGAGGCATCTATGCAGCCTGGGCATTTGTGATCCTGTTGGCTGTGCTGTGTTTGGGGCGGGCCTTCTATTGGGCCTGTATGAAGGTCAGCCACCCTGTCCAGAACTTCTCCTGAGCCCCATGATCACCCACAGACTGTGCCTGGCCCCTTCCTGGTGGGGACAGTGACACTACAAAGGGAACCATAATCAAAGGCTCCCTGGGCTTCTATAAGGGAAGCCAAGCAGCTGCCTTCCTTTTCCCTGGCGAGAGGTAGGAAGGGACCAGGCCCTCACCTAGGTTTGGAGGGGTAGAAAAGGCCACTGTTGGCCTGGCCACCTGCTTTCCTCCAAGAGTTGCTATGTTTAGGGTGAGGTAGGTGAAATGTTGCCCCTAAACCTGGGTCATAAAAGATGGTTCTAGCCATGTCCTTCCTATGTGCTCCCTGAGAGCCATTCCTGTCCCTTACACATTCCAGGGCAGGGTGGGGGTGGGTAGCCCTGGGGGTTTCCCTCCCTCTTGTGTACCATTAGGACCTTGCTGCTGCTATTGCACTTCACCAGGGGCTGGCTCTGGCCTCAGTACCCTCAGTCTCCTCCCCCCATTCCATGTCCTATGGGGGTGGGGTCAGCCGCTGCTCTGTACAGAACCACAGGAACTGATATGTATATAACTATTTAATATGGGGAATGTCCCCCTAGTCCTGTGTTTCCCTTAATTCCTCCTTCCAACCTTACTCCCCAGTGTATTTAACTGGGCTGGGTAGGGTTGCTCTGTTGTGGGGGAGGTTAGGGATTCATCCTGTGCTTGTAAATAAATAAGGTCGTGACTACCCTTTTCCAGTTGTTAATCTGTATGTACAAAAAAAGAGGGGAATTTGTAGCCCCACAGAAGGGTAGAATACAAAGACAGCAAAGTTGAAATTATGGCTCTTTATTTTC