Transcript asmbl_176712

Sequence
Transcript Sequence for observation asmbl_176712 of TGE0005949:
GTCGCCATGGAGATGGGGCCGACCCGCCTGCTCCGCTGCCATTGGCTGGGGACTCCCGGGCTGGAGATATAAGCCAGCGCTCGGCAGATAGTGCACTATCTGTGCAGACAGGACGGGAGACCGCGGTGTCGTTTAGCAGAGCAGAACCGAGTTGAGAAGGTCAGGCTCATCTAGAGGGTGTCGGCGGAAACATGGAGAAACGACTCACATATGAAGATTGTCAGTACACTGCAGAATGGCTTCTGTCCCACACCAAGCACCGACCTCAAGTGGCAGTGATCTGCGGTTCTGGGTTAGGAGGTTTGACTAATAAATTAACTCAGACCCAGATCTTTGACTACAGTGAGATACCAAACTTCCCCCAAAGTACAGTGCAAGGTCATGCTGGTCGACTGGTGTTTGGGTTCCTGAATGACAGAGCCTGTGTGATGATGCAGGGCAGGTTCCACCTGTATGAAGGCTACCCGCTCTGGAAGGTGACATTCCCAGTGAGGGTTTTCCAGCTTCTGGGTGTGCACACCCTCGTGGTCACCAATGCAGCTGGAGGGCTCAACCCCAAGTTTGAGGTTGGAGACATCATGCTAATCCGCGATCACATCAACCTACCTGGTATTTGCGGTGAGAACCCTCTCATAGGGCCCAATGATGAAAGGTATGGAGTTCGTTTTCCTGCCATGTCCGATGCCTATGACCGGGAGATGAGGCAGAAGGCTCATAGTACCTGGAAACAAATGGGAGAGCAGAGAGAGCTACAGGAAGGCACCTACGTTATGGTGACGGGCCCCAGCTATGAGACTGTGGCAGAGTCTCGTCTGCTGCAGCAACTGGGTGCAGATGCTGTTGGCATGAGCACAGTACCAGAAGTTATAGTTGCAAGGCACTGTGGACTTCGAGTCTTTGGCTTCTCCCTCATCACGAACAAGGTCATCATGGATTATGAAAGCCTTGAGAAAACAAACCATGAGGAAGTACTAAAGACCGGGAAACAAGCTGCGCAGAAATTGGAGCAGTTTGTCTCCATTCTTATGACTAGCATTCCACTGCCTGACCATGCTAGTTAACCAGCCCTGGGGTGGTCTGGCTTCTCCCTTATGGTTTCCAAGTAGTTGCTACCTACTTTGCTGGGGTCACATGCCTCTGTCCTTACGCAGTAGCAGAAAAGAGAGGAAGATTTTTATATTTCCCTTTCCCACTTCTCCCACCAGATTCTTCTGGTGCTGGGTCCTCTTTTGCTCAATTGTCTTCTCAAAACAGTGTCCACCTCTATTCTTTCACAAGAGCTGGAGCTCAAGCCAAGCCCTACTACACATCCATAGATATTTGATGTTGGCTGTTGAACTTGACACAGTAGAAGTCGATGCTAGCTTTTTGAGATGATGTTCTCACATTCCTGGGGACTCAGTTCTGCCTCCCCCAAAGTACTGGAAACCACACAAGGACCAGCCCAATACCTTTTATACTTTTAATGCTTTATATTTTGAAAATAAAGAGAAAGATGAAATAATTTCTTCATTTTTGTACAGTTGGGATTAGGCTGGGGCACAGTCCAAGATTGGCCTGAAAGGCTGTGAGACCACATGTGTTATTATGACTATTTGCTTTCTAGACAGGTAGCTAAGAACTGAGATGAGGCGCTATGTGAATGCAGGGAAGGATGAAGAAAAGGCAAGATGATGAAAGATAAAGATATTAGAAGATGATAAGGGAGAAAAGGCTAACTTCTGCGATATGATGGCCACTTCCCTAAGACCAGTCTTGCCTCTGTCCCTTGCCTTCTTTTTTCACCTCCTCTCTACTCTCATAAATATCTGAATTAGTTCACGATCTCCACTGTTCTTTCTCTTCCACTGTTGCCAGTTCCTTGTTAAGCCCTAATTATATTTCCTCCTTTTTTGCTTATTTTTATTTTTATTTTTTATTAAATTTATTGGGGTGAGATTGGTCAATAAAATTATATAGGTTTCAAG