Transcript asmbl_176297

Sequence
Transcript Sequence for observation asmbl_176297 of TGE0005942:
GTAGACTCCGACCATCAGGCTGACGTTGCCCCGGCTACGCCTCTCCCGCCCGCCACGGCGTAGCTGGCGATTGGTGGAGAAGGCGACAGCTGTCCCAGCGGAGGCGACGACGGGGCGGCCTCAAGGAGTCGCAACGAGCCAGAGCGCGTCACGCCCTGGTGCTGCGGTGGTCGCTCGCGTCTTGTCGGCCCGTTCCGTGTTGCCCTGCACTGCCGCGGCCGCCGCGGAACCATGGCTGTGCTCGTCGTGCTGTTGTCCTTGGTGGCGGGTGTTTTGGGAAACGAGTTTAGTATTTTAAGATCACCGGGGTCTGTTGTTTTCCGGGATGGAAATTGGCCTATACCAGGAGAGCGAATCCCAGATGTTGCTGCATTATCCATGGGCTTCTCTGTGAAAGAAGATCTTTCTTGGCCAGGACTTGCAGTTGGTAACCTATTCCATCGTCCTCGGGCTACCGTTATGGTGATGGTGAAGGGAGTGGACAAACTCGCTCTACCCCCAGGCAGTGCCATTTCATACCCTTTGGAGAATGCAGTTCCTTTTAGTCTCGACAGTGTTGCAAATTCCATTCACTCCTTATTTTCTGAAGAAACTCCTGTAGTTTTGCAGTTGGCTCCCAGTGAGGAAAGAGTGTATATGGTGGGAAAGGCAAACTCAGTTTTTGAAGATCTTTCAGTAACGTTACGACAGCTCCGCAATCGCCTGTTTCAAGAAAATTCCATTCTCAATGCACTTCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGATCTGCTCTTTCTTTCTGAACTGCAAGTTCTACATGATATTTCAAGTTTGTTGTCTCGACATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAACATTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTATAGTCTTTATGGTGGGAATGCAGTGGTAGAGCTAGTGACTGTCAGATCATTCGACACATCCCTTGTGAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGAGAACCCACCAAGTCCCTTTAACCTTGCATATAAGTATAATTTTGAGTATCCAGTGGTTTTCAATATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGATATGATAGCATCATTTATAGGATGACAAACCAGAAGATTCGAATGGATTGAACTTTCCTTATGCCTAACTTAGAAAAGGGGTTTGGAAATTGTTTTCTTAAAATAAATCTTTAGTGTAGTTTAAAGTAGATAGTATACTTTAAATTTTTTAAAGAAGTAAATTTTGTTCTCAGTTTTGTGTGTGCTTGTGAAGTTGTTTTAGAGTGAATTATGGTATTGATGTGAATTGATTTGTGTGATATAAATTCCATAATATCCTCAAATATTATGATATAACCATTTAATATAATTTCATTCCATTTAATATTTGGAAATAATGCACTGAAATAAATGTAAAACATTTAGAATAGCTTGTGTTATTTATGTTAGGAAAATGCACTGAATTTGTTAGAGGCACTTATGAATGCTTAATTTCCTTACACAGGACAGATTTAAATGATATTTGGGCTATTGTGTACTATGAACTATTTGTAAATGTCCTAATTTGATGTAAATATCTCTGAAACGAGAAATGGTTTTCACTTAGCACAGCCCTCAACTATGAGTGTGTGTATACAGTCACTTTGATTTGGAACTGCATCTGATTGACAGAGGATAGCTGTTTTTTTAACCTCTTCTGAAAGTTTGGTGATCTGGATGGTCTAGTGTGGGTATTAAAAATACTACATTGATCTCAGAAGAAACTAGCTTTGTGAAGTTACAGATATTCATAATTATACACATAAAAACAAACATTTGGGGGACATCTTGGGGCATGAATATAAAAATCTTTTTATTTCAGTTAACTTTTCCCACTGTGTAAGTTACTATGGTTTGTGGTACATCATTCTATAGAATATTAAGTGAAAGTAGATGCTCCTTACTTTTCATGTGGAAGTGGACCAATGTCTATAAAGAGTCACAAATAAAGTTAATGATTCCAAATTTGTGTCATTTCAATACTAAATCTATTTTATATTGTAAAACCCTAACAGGGTTTTATTTAGTCAGAATTGACTGTTTTCATTATACAAATGGTTTTGCGCTTTTTTTATTGTTTTATTATTTTCTGGTTACATTATTTTTTAAATGTTTTTTTTATTTTTCAGTTACAGTTG