Transcript asmbl_57228

Sequence
Transcript Sequence for observation asmbl_57228 of TGE0006406:
CCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATATGCTAGTATGCTTTATGTACACAAATTGAGAAGATATATTGATGTTAACATAAATACCTTTATAATTCTACTTTGGGCTCTATGTCTTCATATTTGATGCATGTGGGTAGGTAGCTGTAGCAGGTTGCTAGAAGTTTAGAGGTGGGAAGGAGGGAATTCTCATGTTCAATATCATCATCTTGGTCTAATCTGAACTCTTTAGTATTCTGCATACAAAATTGGATAAGATCATTGTGCATGTTTAGAGTTAAGCTCCAGTTTGCATACTTTGCTTAGAATTTTTGGAAATAGTTTTTAAAAGAAAATTGTCAATTATTGGAAAATCATTATAGTGGATTGAAAGAATTTTCATATAAAATTCACATTTACCTCATATTTGTGTGGCACATATGTTGCAGGCGAGAATTCTGTCAGAGAACCACCAGTACGCCAGTTGTATTGCACATATTTTGATATTTTTGCTTCACTGATTAAAATAATGGTAAACTTGA