Transcript asmbl_175037

Sequence
Transcript Sequence for observation asmbl_175037 of TGE0005882:
ATTCAGGACATTCTGAAGGTGCTGGTGTCCGACCTTAACCGCTCCAATGGGGTAGTGCTCCCCCCATTGGACAAGTGGAAGGTGAGGCAGTGCCAAGACCCCTCTCTGGCTTGCTCTCTCCCAGCTGTGCATGTCCCCAAGGCTTCTCTGATTTGGGGGATACTTCGCCTCTGGCTTATTTTATGTTGCTGCCATTAACCCTCAGCCCGTTAATGTTTGCTTTTTCACCTGCTTGGTTGATTGGGTTTTGTTTCCCCTCCCCCACATCTTTTATCATCTTGGAGAAGGCAAGATGTACCTTGAAGGCTAAAGGTAATTTGGGAATAGCTTCTAGAGCAGGTGTGTGGGATATGGGCTTTTTGAGCCTCAAGTTTGAGTGTCCCAGTGGTGCTTTCAGACTAGGAGAGATTAAATAAAACCAGACTTTCAAGTCTTGTCCTGTGGGCATCTGTCCTCAAAAGACCGAGAGACCACAGAGCAGTTTGTGATTTTTCAAATTGACTAATTCATTTTGGTTTGAGTCAGCAACCTAGGGTTACAAAAAAGGGAGTTTGCATTAGAGTTATAGAGATACTAAGGATGTGAAGTTAAACAAACAGATGAGTGACCAGGACATTTCGCCCCGATGCTCTTTTAAAAATCAACTGGACACTTAACCATATTCAGTGGGCCCTTGACAGCAGAGGCACTTGGCTAAGTGCTGGAGAAGATAGGGGAACCAGATAGAATGCCCACTGAGGGAGGCAGGCTCCCCTGAAAGAGGCAAGATAAAGTGTGGCAACATTCCAGATGCTCGGCTGAGGGCGAGGTTGGTTTTAAATGGATTCGAGGTGGAGGGGGTGGCATTTGAGGTTCGTTTGAAGATTAGCGGTGGGTAACGGCCTTCCATATGGAGAGAGAGGGAAATAGTCCTAGGCCGAGGGCGCGGTGCAGGTAGCGGCCAGGGTTATGAGCTCACAGAGCACATCCCAGAAAGTCGAGGAGCCAGGAGCTGACCTCTCCCGGACGTGATGTTGGCACTTCCTCCTTCATTAACTTTCTCGGAGGACATCTGCCAGGCCGGAGGAGTAGAGCTGAAATGGGGCCAGGTCCTGTTGGAGAAGGGTGTGGGGAAAGGGGCTGGGACAGGGCACTGCTGGCTGGTGTTAGAGTCTTTTCAGTCATCGGGACTGCTCACGCCCAGTCAGGCAGGCCTCTCCATGTTGTGTGACTCACCTTGTCGACTCAGAGGAGCACCGAGTGGCATGGGGAAGACAGCACAGGCCTAAAGGAGTCCTGAAGCTGAGTATTTACGCTCATGTTCTGCACCCATGTCCCTCTGTTGTCTTGGAAATGAAGACACAGATTCTCATAGTCCCTTCGTGCTGATTTTAAATCCTCTCTTTATCAGTTACTGTTTCCCACTTAAGTTTTCTGTTCCAATAATGCAGGCCTGTGAATGCAGTATCCTGGGCAGAAATGATAGCATTTCCAGAAGTGGGGAATAATGGAGAAATAAAAAGATTTTTAATGGAGTGGGACAGTTGAGGAGAGTGGACAATGTTTATTTTTTTGAACTCCAGACTTAGCTACAGGACCTAAAATTAGGAAATAACTTGGTTGCTCACAGAATAGTCATGCTATGTATATTTAAGTTCTCAGAAAAATACTTTATTTCCCCTTTGGAACTTTCTCGTGTCTAATGCTAGGGATCAATGGGAATCCCAAGATGCCAAGAGGGACCCAGAGCTGGCCAGGGCCCATGGTTGGGAGGGTGCCACCTCCCCCAAAGTATTCTGCCTGCCCAACTCTGAACCCCTGCTCTAGCCTATTAGAGTCAATTATATAGGTTGGCAAGGCAACACTGATTCCAATGTCAAAGGTCACAGTGTGGACAGTAAACCAGCAAATAGCTTGACCCAGCCTCAGCTCCCCCAGGCTCTTTAGCACTCGCTCTAAGATGGGCAGCAGATCGGGGTTTTCAGAGGCCAGGACTGAGGGGTCCAGCAGGCAGTCAGCCCTTTTCCCCCGCAGAGAGGTGCAGCCTCTTCCTCCTGGACCCAACTTCACTGCACAGGTCTTGGCTCCCTAGCACTTTTCCCTCATCAGGCCTCAGTTTGTCACCCATCTTCCCCATCTCTGCTCACCTGGCCTGTTGGACATTAGCTCTCTAGAGCGGGAGGCTTGGACTAAGTGTCAGGCCTGAGCCTGCAGGGAGGCTGGGTGGGGCTCTGGTAAAGCAGGTGGGTCCAGTTGGGGAAGAGAGAGTGGCTGGTCCTCGATCCCAGGATTGTTCTTCAGGAAGCCGAGCGTCAAAGGGCGGACAGTTACTCCTGGTTTCTCAGGTGGTTTCTTGCTTGGGTAGGTGTTTTGGGACTAGGAGGTTGGGGTGGGGTTACTTTTTACCTCCAAGAACAGGGAGAGTCTTCTAGTTGGCCAGCTTCTTTCCCAGAAAAGGCCTTAGTCAGGCAGACGCGGTCACTGGTTGGTGGGGGAGTGGAGGAAAGAAAGGGGAGCGTGAGGGGAAGGAGGCAGAGCTGCGCTGACCACATCAGCTTCTTCACTGCCACCCTGCACCCGCTGGGGCCCGTAGTGAGGCACAGACAGGCTTTCTGGAAGAACAGTGCCTTCTTCTCCCTGACTCGGCACACCTTCCTCCCACCTGCTGGGACTGCCGCAGCTCAGACCCTGATACTGTCTTTTGCTGAATGCCAGGGAGAACAAGGCCCCCATATGTTCACGAAGGAGGTCGTGCAGAACTGCTCTGAGCTCTGGCTGGCCCGAAGGCTGCAGAGCGGCCTGAGCCCTGGGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAGCCGGTATCAAGAGCTATCTCTAGCCCTGGACTCCAGCAATCTAACAAACAAACAACTCATTAGCAAGATAGAGGAATTGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGACTCCTGTTTGTTTTACTTTTTATTTCAGAATAAATGAATTTAGCCATA