Transcript asmbl_175036

Sequence
Transcript Sequence for observation asmbl_175036 of TGE0005882:
ATTCAGGACATTCTGAAGGTGCTGGTGTCCGACCTTAACCGCTCCAATGGGGTAGTGCTCCCCCCATTGGACAAGTGGAAGGTGAGGCAGTGCCAAGACCCCTCTCTGGCTTGCTCTCTCCCAGCTGTGCATGTCCCCAAGGCTTCTCTGATTTGGGGGATACTTCGCCTCTGGCTTATTTTATGTTGCTGCCATTAACCCTCAGCCCGTTAATGTTTGCTTTTTCACCTGCTTGGTTGATTGGGTTTTGTTTCCCCTCCCCCACATCTTTTATCATCTTGGAGAAGGCAAGATGTACCTTGAAGGCTAAAGGTAATTTGGGAATAGCTTCTAGAGCAGGTGTGTGGGATATGGGCTTTTTGAGCCTCAAGTTTGAGTGTCCCAGTGGTGCTTTCAGACTAGGAGAGATTAAATAAAACCAGACTTTCAAGTCTTGTCCTGTGGGCATCTGTCCTCAAAAGACCGAGAGACCACAGAGCAGTTTGTGATTTTTCAAATTGACTAATTCATTTTGGTTTGAGTCAGCAACCTAGGGTTACAAAAAAGGGAGTTTGCATTAGAGTTATAGAGATACTAAGGATGTGAAGTTAAACAAACAGATGAGTGACCAGGACATTTCGCCCCGATGCTCTTTTAAAAATCAACTGGACACTTAACCATATTCAGTGGGCCCTTGACAGCAGAGGCACTTGGCTAAGTGCTGGAGAAGATAGGGGAACCAGATAGAATGCCCACTGAGGGAGGCAGGCTCCCCTGAAAGAGGCAAGATAAAGTGTGGCAACATTCCAGATGCTCGGCTGAGGGCGAGGTTGGTTTTAAATGGATTCGAGGTGGAGGGGGTGGCATTTGAGGTTCGTTTGAAGATTAGCGGTGGGTAACGGCCTTCCATATGGAGAGAGAGGGAAATAGTCCTAGGCCGAGGGCGCGGTGCAGGTAGCGGCCAGGGTTATGAGCTCACAGAGCACATCCCAGAAAGTCGAGGAGCCAGGAGCTGACCTCTCCCGGACGTGATGTTGGCACTTCCTCCTTCATTAACTTTCTCGGAGGACATCTGCCAGGCCGGAGGAGTAGAGCTGAAATGGGGCCAGGTCCTGTTGGAGAAGGGTGTGGGGAAAGGGGCTGGGACAGGGCACTGCTGGCTGGTGTTAGAGTCTTTTCAGTCATCGGGACTGCTCACGCCCAGTCAGGCAGGCCTCTCCATGTTGTGTGACTCACCTTGTCGACTCAGAGGAGCACCGAGTGGCATGGGGAAGACAGCACAGGCCTAAAGGAGTCCTGAAGCTGAGTATTTACGCTCATGTTCTGCACCCATGTCCCTCTGTTGTCTTGGAAATGAAGACACAGATTCTCATAGTCCCTTCGTGCTGATTTTAAATCCTCTCTTTATCAGTTACTGTTTCCCACTTAAGTTTTCTGTTCCAATAATGCAGGCCTGTGAATGCAGTATCCTGGGCAGAAATGATAGCATTTCCAGAAGTGGGGAATAATGGAGAAATAAAAAGATTTTTAATGGAGTGGGACAGTTGAGGAGAGTGGACAATGTTTATTTTTTTGAACTCCAGACTTAGCTACAGGACCTAAAATTAGGAAATAACTTGGTTGCTCACAGAATAGTCATGCTATGTATATTTAAGTTCTCAGAAAAATACTTTATTTCCCCTTTGGAACTTTCTCGTGTCTAATGCTAGGGATCAATGGGAATCCCAAGATGCCAAGAGGGACCCAGAGCTGGCCAGGGCCCATGGTTGGGAGGGTGCCACCTCCCCCAAAGTATTCTGCCTGCCCAACTCTGAACCCCTGCTCTAGCCTATTAGAGTCAATTATATAGGTTGGCAAGGCAACACTGATTCCAATGTCAAAGGTCACAGTGTGGACAGTAAACCAGCAAATAGCTTGACCCAGCCTCAGCTCCCCCAGGCTCTTTAGCACTCGCTCTAAGATGGGCAGCAGATCGGGGTTTTCAGAGGCCAGGACTGAGGGGTCCAGCAGGCAGTCAGCCCTTTTCCCCCGCAGAGAGGTGCAGCCTCTTCCTCCTGGACCCAACTTCACTGCACAGGTCTTGGCTCCCTAGCACTTTTCCCTCATCAGGCCTCAGTTTGTCACCCATCTTCCCCATCTCTGCTCACCTGGCCTGTTGGACATTAGCTCTCTAGAGCGGGAGGCTTGGACTAAGTGTCAGGCCTGAGCCTGCAGGGAGGCTGGGTGGGGCTCTGGTAAAGCAGGTGGGTCCAGTTGGGGAAGAGAGAGTGGCTGGTCCTCGATCCCAGGATTGTTCTTCAGGAAGCCGAGCGTCAAAGGGCGGACAGTTACTCCTGGTTTCTCAGGTGGTTTCTTGCTTGGGTAGGTGTTTTGGGACTAGGAGGTTGGGGTGGGGTTACTTTTTACCTCCAAGAACAGGGAGAGTCTTCTAGTTGGCCAGCTTCTTTCCCAGAAAAGGCCTTAGTCAGGCAGACGCGGTCACTGGTTGGTGGGGGAGTGGAGGAAAGAAAGGGGAGCGTGAGGGGAAGGAGGCAGAGCTGCGCTGACCACATCAGCTTCTTCACTGCCACCCTGCACCCGCTGGGGCCCGTAGTGAGGCACAGACAGGCTTTCTGGAAGAACAGTGCCTTCTTCTCCCTGACTCGGCACACCTTCCTCCCACCTGCTGGGACTGCCGCAGCTCAGACCCTGATACTGTCTTTTGCTGAATGCCAGGGAGAACAAGGCCCCCATATGTTCACGAAGGAGGTCGTGCAGAACTGCTCTGAGCTCTGGCTGGCCCGAAGGCTGCAGAGCGGCCTGAGCCCTGGGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGACTCCTGTTTGTTTTACTTTTTATTTCAGAATAAATGAATTTAGCCATA