Transcript asmbl_175035

Sequence
Transcript Sequence for observation asmbl_175035 of TGE0005882:
ATTCAGGACATTCTGAAGGTGCTGGTGTCCGACCTTAACCGCTCCAATGGGGTAGTGCTCCCCCCATTGGACAAGTGGAAGGTGAGGCAGTGCCAAGACCCCTCTCTGGCTTGCTCTCTCCCAGCTGTGCATGTCCCCAAGGCTTCTCTGATTTGGGGGATACTTCGCCTCTGGCTTATTTTATGTTGCTGCCATTAACCCTCAGCCCGTTAATGTTTGCTTTTTCACCTGCTTGGTTGATTGGGTTTTGTTTCCCCTCCCCCACATCTTTTATCATCTTGGAGAAGGCAAGATGTACCTTGAAGGCTAAAGGTAATTTGGGAATAGCTTCTAGAGCAGGTGTGTGGGATATGGGCTTTTTGAGCCTCAAGTTTGAGTGTCCCAGTGGTGCTTTCAGACTAGGAGAGATTAAATAAAACCAGACTTTCAAGTCTTGTCCTGTGGGCATCTGTCCTCAAAAGACCGAGAGACCACAGAGCAGTTTGTGATTTTTCAAATTGACTAATTCATTTTGGTTTGAGTCAGCAACCTAGGGTTACAAAAAAGGGAGTTTGCATTAGAGTTATAGAGATACTAAGGATGTGAAGTTAAACAAACAGATGAGTGACCAGGACATTTCGCCCCGATGCTCTTTTAAAAATCAACTGGACACTTAACCATATTCAGTGGGCCCTTGACAGCAGAGGCACTTGGCTAAGTGCTGGAGAAGATAGGGGAACCAGATAGAATGCCCACTGAGGGAGGCAGGCTCCCCTGAAAGAGGCAAGATAAAGTGTGGCAACATTCCAGATGCTCGGCTGAGGGCGAGGTTGGTTTTAAATGGATTCGAGGTGGAGGGGGTGGCATTTGAGGTTCGTTTGAAGATTAGCGGTGGGTAACGGCCTTCCATATGGAGAGAGAGGGAAATAGTCCTAGGCCGAGGGCGCGGTGCAGGTAGCGGCCAGGGTTATGAGCTCACAGAGCACATCCCAGAAAGTCGAGGAGCCAGGAGCTGACCTCTCCCGGACGTGATGTTGGCACTTCCTCCTTCATTAACTTTCTCGGAGGACATCTGCCAGGCCGGAGGAGTAGAGCTGAAATGGGGCCAGGTCCTGTTGGAGAAGGGTGTGGGGAAAGGGGCTGGGACAGGGCACTGCTGGCTGGTGTTAGAGTCTTTTCAGTCATCGGGACTGCTCACGCCCAGTCAGGCAGGCCTCTCCATGTTGTGTGACTCACCTTGTCGACTCAGAGGAGCACCGAGTGGCATGGGGAAGACAGCACAGGCCTAAAGGAGTCCTGAAGCTGAGTATTTACGCTCATGTTCTGCACCCATGTCCCTCTGTTGTCTTGGAAATGAAGACACAGATTCTCATAGTCCCTTCGTGCTGATTTTAAATCCTCTCTTTATCAGTTACTGTTTCCCACTTAAGTTTTCTGTTCCAATAATGCAGGCCTGTGAATGCAGTATCCTGGGCAGAAATGATAGCATTTCCAGAAGTGGGGAATAATGGAGAAATAAAAAGATTTTTAATGGAGTGGGACAGTTGAGGAGAGTGGACAATGTTTATTTTTTTGAACTCCAGACTTAGCTACAGGACCTAAAATTAGGAAATAACTTGGTTGCTCACAGAATAGTCATGCTATGTATATTTAAGTTCTCAGAAAAATACTTTATTTCCCCTTTGGAACTTTCTCGTGTCTAATGCTAGGGATCAATGGGAATCCCAAGATGCCAAGAGGGACCCAGAGCTGGCCAGGGCCCATGGTTGGGAGGGTGCCACCTCCCCCAAAGTATTCTGCCTGCCCAACTCTGAACCCCTGCTCTAGCCTATTAGAGTCAATTATATAGGTTGGCAAGGCAACACTGATTCCAATGTCAAAGGTCACAGTGTGGACAGTAAACCAGCAAATAGCTTGACCCAGCCTCAGCTCCCCCAGGCTCTTTAGCACTCGCTCTAAGATGGGCAGCAGATCGGGGTTTTCAGAGGCCAGGACTGAGGGGTCCAGCAGGCAGTCAGCCCTTTTCCCCCGCAGAGAGGTGCAGCCTCTTCCTCCTGGACCCAACTTCACTGCACAGGTCTTGGCTCCCTAGCACTTTTCCCTCATCAGGCCTCAGTTTGTCACCCATCTTCCCCATCTCTGCTCACCTGGCCTGTTGGACATTAGCTCTCTAGAGCGGGAGGCTTGGACTAAGTGTCAGGCCTGAGCCTGCAGGGAGGCTGGGTGGGGCTCTGGTAAAGCAGGTGGGTCCAGTTGGGGAAGAGAGAGTGGCTGGTCCTCGATCCCAGGATTGTTCTTCAGGAAGCCGAGCGTCAAAGGGCGGACAGTTACTCCTGGTTTCTCAGGTGGTTTCTTGCTTGGGTAGGTGTTTTGGGACTAGGAGGTTGGGGTGGGGTTACTTTTTACCTCCAAGAACAGGGAGAGTCTTCTAGTTGGCCAGCTTCTTTCCCAGAAAAGGCCTTAGTCAGGCAGACGCGGTCACTGGTTGGTGGGGGAGTGGAGGAAAGAAAGGGGAGCGTGAGGGGAAGGAGGCAGAGCTGCGCTGACCACATCAGCTTCTTCACTGCCACCCTGCACCCGCTGGGGCCCGTAGTGAGGCACAGACAGGCTTTCTGGAAGAACAGTGCCTTCTTCTCCCTGACTCGGCACACCTTCCTCCCACCTGCTGGGACTGCCGCAGCTCAGACCCTGATACTGTCTTTTGCTGAATGCCAGGGAGAACAAGGCCCCCATATGTTCACGAAGGAGGTCGTGCAGAACTGCTCTGAGCTCTGGCTGGCCCGAAGGCTGCAGAGCGGCCTGAGCCCTGGGTGAGCCATAGCCACACCTCAGAGTGGCTTCCAGCATGTGTGACTGTCACTCTGATTGCAGCAACACCTGTCCTACCCGCTCCACACCCTGCATCCATGGCAGTGAGATGTCTTCTTTCCCACATGGCTCCCTAACCCCCTGCTCTGTTCTGTGACAGGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAGCCGGTATCAAGAGCTATCTCTAGCCCTGGACTCCAGCAATCTAACAAACAAACAACTCATTAGCAAGATAGAGGAATTGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGACTCCTGTTTGTTTTACTTTTTATTTCAGAATAAATGAATTTAGCCATA