Transcript asmbl_175034

Sequence
Transcript Sequence for observation asmbl_175034 of TGE0005882:
ATTCAGGACATTCTGAAGGTGCTGGTGTCCGACCTTAACCGCTCCAATGGGGTAGTGCTCCCCCCATTGGACAAGTGGAAGGTGAGGCAGTGCCAAGACCCCTCTCTGGCTTGCTCTCTCCCAGCTGTGCATGTCCCCAAGGCTTCTCTGATTTGGGGGATACTTCGCCTCTGGCTTATTTTATGTTGCTGCCATTAACCCTCAGCCCGTTAATGTTTGCTTTTTCACCTGCTTGGTTGATTGGGTTTTGTTTCCCCTCCCCCACATCTTTTATCATCTTGGAGAAGGCAAGATGTACCTTGAAGGCTAAAGGTAATTTGGGAATAGCTTCTAGAGCAGGTGTGTGGGATATGGGCTTTTTGAGCCTCAAGTTTGAGTGTCCCAGTGGTGCTTTCAGACTAGGAGAGATTAAATAAAACCAGACTTTCAAGTCTTGTCCTGTGGGCATCTGTCCTCAAAAGACCGAGAGACCACAGAGCAGTTTGTGATTTTTCAAATTGACTAATTCATTTTGGTTTGAGTCAGCAACCTAGGGTTACAAAAAAGGGAGTTTGCATTAGAGTTATAGAGATACTAAGGATGTGAAGTTAAACAAACAGATGAGTGACCAGGACATTTCGCCCCGATGCTCTTTTAAAAATCAACTGGACACTTAACCATATTCAGTGGGCCCTTGACAGCAGAGGCACTTGGCTAAGTGCTGGAGAAGATAGGGGAACCAGATAGAATGCCCACTGAGGGAGGCAGGCTCCCCTGAAAGAGGCAAGATAAAGTGTGGCAACATTCCAGATGCTCGGCTGAGGGCGAGGTTGGTTTTAAATGGATTCGAGGTGGAGGGGGTGGCATTTGAGGTTCGTTTGAAGATTAGCGGTGGGTAACGGCCTTCCATATGGAGAGAGAGGGAAATAGTCCTAGGCCGAGGGCGCGGTGCAGGTAGCGGCCAGGGTTATGAGCTCACAGAGCACATCCCAGAAAGTCGAGGAGCCAGGAGCTGACCTCTCCCGGACGTGATGTTGGCACTTCCTCCTTCATTAACTTTCTCGGAGGACATCTGCCAGGCCGGAGGAGTAGAGCTGAAATGGGGCCAGGTCCTGTTGGAGAAGGGTGTGGGGAAAGGGGCTGGGACAGGGCACTGCTGGCTGGTGTTAGAGTCTTTTCAGTCATCGGGACTGCTCACGCCCAGTCAGGCAGGCCTCTCCATGTTGTGTGACTCACCTTGTCGACTCAGAGGAGCACCGAGTGGCATGGGGAAGACAGCACAGGCCTAAAGGAGTCCTGAAGCTGAGTATTTACGCTCATGTTCTGCACCCATGTCCCTCTGTTGTCTTGGAAATGAAGACACAGATTCTCATAGTCCCTTCGTGCTGATTTTAAATCCTCTCTTTATCAGTTACTGTTTCCCACTTAAGTTTTCTGTTCCAATAATGCAGGCCTGTGAATGCAGTATCCTGGGCAGAAATGATAGCATTTCCAGAAGTGGGGAATAATGGAGAAATAAAAAGATTTTTAATGGAGTGGGACAGTTGAGGAGAGTGGACAATGTTTATTTTTTTGAACTCCAGACTTAGCTACAGGACCTAAAATTAGGAAATAACTTGGTTGCTCACAGAATAGTCATGCTATGTATATTTAAGTTCTCAGAAAAATACTTTATTTCCCCTTTGGAACTTTCTCGTGTCTAATGCTAGGGATCAATGGGAATCCCAAGATGCCAAGAGGGACCCAGAGCTGGCCAGGGCCCATGGTTGGGAGGGTGCCACCTCCCCCAAAGTATTCTGCCTGCCCAACTCTGAACCCCTGCTCTAGCCTATTAGAGTCAATTATATAGGTTGGCAAGGCAACACTGATTCCAATGTCAAAGGTCACAGTGTGGACAGTAAACCAGCAAATAGCTTGACCCAGCCTCAGCTCCCCCAGGCTCTTTAGCACTCGCTCTAAGATGGGCAGCAGATCGGGGTTTTCAGAGGCCAGGACTGAGGGGTCCAGCAGGCAGTCAGCCCTTTTCCCCCGCAGAGAGGTGCAGCCTCTTCCTCCTGGACCCAACTTCACTGCACAGGTCTTGGCTCCCTAGCACTTTTCCCTCATCAGGCCTCAGTTTGTCACCCATCTTCCCCATCTCTGCTCACCTGGCCTGTTGGACATTAGCTCTCTAGAGCGGGAGGCTTGGACTAAGTGTCAGGCCTGAGCCTGCAGGGAGGCTGGGTGGGGCTCTGGTAAAGCAGGTGGGTCCAGTTGGGGAAGAGAGAGTGGCTGGTCCTCGATCCCAGGATTGTTCTTCAGGAAGCCGAGCGTCAAAGGGCGGACAGTTACTCCTGGTTTCTCAGGTGGTTTCTTGCTTGGGTAGGTGTTTTGGGACTAGGAGGTTGGGGTGGGGTTACTTTTTACCTCCAAGAACAGGGAGAGTCTTCTAGTTGGCCAGCTTCTTTCCCAGAAAAGGCCTTAGTCAGGCAGACGCGGTCACTGGTTGGTGGGGGAGTGGAGGAAAGAAAGGGGAGCGTGAGGGGAAGGAGGCAGAGCTGCGCTGACCACATCAGCTTCTTCACTGCCACCCTGCACCCGCTGGGGCCCGTAGTGAGGCACAGACAGGCTTTCTGGAAGAACAGTGCCTTCTTCTCCCTGACTCGGCACACCTTCCTCCCACCTGCTGGGACTGCCGCAGCTCAGACCCTGATACTGTCTTTTGCTGAATGCCAGGGAGAACAAGGCCCCCATATGTTCACGAAGGAGGTCGTGCAGAACTGCTCTGAGCTCTGGCTGGCCCGAAGGCTGCAGAGCGGCCTGAGCCCTGGGTGAGCCATAGCCACACCTCAGAGTGGCTTCCAGCATGTGTGACTGTCACTCTGATTGCAGCAACACCTGTCCTACCCGCTCCACACCCTGCATCCATGGCAGTGAGATGTCTTCTTTCCCACATGGCTCCCTAACCCCCTGCTCTGTTCTGTGACAGGCGCCCAAAGACTGCGCCGCTCCTGCAGCACCACCTGCTGATGACACCATGTCACCTGGCGGTGTCATTTCCCCCTGTGCTGGTCCCTCCCATGTCACTAGCATGGCATCAACTCAGAACCATGACGCTGAAAATGGTCCTAGTCCCATGGATGGAAGCAAATTCTCATCTACCGAGAGCCTACGTCAGCTTTCTCAGCAGCTCAACGGTCTTGTGTCCGAGTCTACATCCTACATCAACGGGGAGGGCCTAGCATCTTCTGCTAACATAAAGGCTCTGGAGAAACAACAGAACCAGGAAACTGTGGATCAACTGGAAAAAGAGAAGGCAGAATGTGAGCAAAAGCGCTTGAAGGAGCAGGGGGCTCTGAGAGAGCAGCTGCAGGTTCATATCCAGACCATCGGGATTCTAGTATCTGAGAAGACGGAATTACAGACGGCCCTGTCCCATACCCACCAGGCAGTCAGGCACAAAGCAGGAGAGGTGGAGGATCTTATCTGTCGCCTGAAGTCTTCCCGGCAGCGCATCGCTGAGCTGGAGCGGACGCTGTCTGCTATCTCCACGCAGCAGAAACAGGCGGACAGGTACACCAAGGAATTAACCAAAGATCGAGATACCCTCAGGCTGGAGTTATACAGGAGCAACAAAGCCAATGAGGACCTGAAGCAGCAGAACTCAGAACTGGAGGAGAAGCTTCGGGTCTTGGTGACTGAGAATTCGGCTATGCAACTCAGGTTTGAGGAGTCGCAAAAAAAGCTGGAGATGTCAGAGCTGCTGGTGCAGCAGCTTTCCAGTCAGTCTGAAACCTCTGATAGCAAGCAGCAGTTAGAGCAGGCCCTTTTTTTTCAAAGCTGGAGGCACATGTGGAGCAGTTGAAGGATTTGCTGAAGCAACTGCAGATGGAGAGAGACCAGTACGCGGAGAATCTGAAAGAAGAGAATGCCATTTGGCAACAGAGGATGGAGCAGATGTCAGAGAAGATGTGCAAGTTGAGGGAGGAGAAGGAGCAGAGCGTGAGTCAGGTGCAGGAGCTGGAGACCAGGTTGACTGAACTGAGGAACCAGATAGCCGTTCCCCCACCCCAGCAGCCCCCAGCAGGGCCTTCGGAGATGGAACAGCGGCTGGAAGCCGAGGCCAGGCAGCTACAGAAGGAACTAGAGAGCCTGGCGGGGCAGCTGCAGGCCCAGGTGCAAGACAACGAGGGTCTGAGCCGTCTGAATCGGGAGCAGGAGCAGCGGCTGCTGGAGCTGGAGCAGGCTGCCGAGCGCTGGGGCGAGCAGGCGGAGGAGCGCAAGCGGGTGCTGGAGACCATGCAGAGCGACCGCACGACCATCAGCCGCGCTCTCTCCCAGAACCGGGAGCTCAAGGAGCAGCTGGCCGAGCTGCAGAACGGCTTTGTCAGGCTGACCAACGAGAACATGGAGATTACCAGCGCGTTTCAGTCGGAGCAGCATGTCAAGAAGGAGCTGGCCAAGAAGCTGGACCAGCTGCAGGAGAAGCTGGAGGAGCTGAAGGAGACGGTGGAGCTGAAGAGCCAAGAGGCCCAGAGTCTGCAGCAGCAGCGGGACCAGTACCTGAGCCACCTGCAGCAGTATGTGGTCAGTTATCAGCAGCACGTGGCCGCCTACCAGCAGCTGGCCTCCGAGAAAGAGGTGCTGCACAAACAGGTCCTGCTACAGACCGAGCTCATGGACCAGCTACAGCATGAGGAAGTTCAGGTCAAGATGGAGGCCGACATGGCCCGCCAAGAGTTGCAGGAGACCCAGGAGCGCTTGGAAGCTGCCAACCAGCAGAATCACAATCTACAGGCCCAGCTGAGCCTCATGGCTCTGCCTGGGGAAGGAGACGGAGTGGACATTGAGGAGGAGGACAAAGAGGCTCCCCGGCCAAAGCTGAGCATGCCGGAGGACCTAGAGAGCCCAGAGGCCATGGTGGCATTTTTTAACTCGGCCTTAGCCAGTGCTGATGAAGAGCAGGCACGGCTGCGTGGGCAGCTCAAGGAGCAGAAGCTGCACTGCCGGCGCCTGGCTCAGCTGGCAGCCCCGTCCCAGCACCCGCTGGAGGGGGAGGCCCCAGCCCCCCGCACTGGGGGAAACGGTGTGCCCGCAGAGAGGCACCAGGCCCTCCAGGTGGCCATGGACAAGCTGCAGGGCCGCTTTACAGAGCTCATGCAGGAGAAAGTGGACTTGAAGGACCGTGTAGAGGAGCTGGAGCATCGCTGCATCCAGCTGTCTGGAGAGACGGACACTATTGGAGAGTACATCGCCCTGTACCAGAGCCAGAGGGCTGTGCTGAAGGAGCGGCACCGGGAGAAGGAGGAGTACATCAGCCGGCTGGCTCAGGACAAGGAGGAAATGAAGGTGAAGCTCCTGGAGCTGCAGGAGCTGGTGTTACGCCTGGTGGGCGAGCGGAATGAATGGTATGGCAAGTTCTTGGCGGCTGCCCAGAACCCTGCTGGTGAGCCCAGTGCAGTGGCCCCGGCCCCCCAGGAGAATGTTGCTGCTGACAGCCAGGGTGATCTCCATGAAGTGAGCCTTGCTGACAATGTGGAGCCTACTCAGGGAGAGGCCCTGCCGGGCCTGGCTACTCCCCCTGAGAACCCCACCGCACAGCAGATTATGCAGCTGCTGCGAGAGATCCAGAACCCCCAGGAGCGCCCAGGCTTGGGCAGCAACCCCTGCATCCCCTTCTTCTACCGGGCTGATGACAATGACGAGGTGAAGATCATGGTCATCTAACGCCTGACACTAAAAGACAAAGCTTGGAGAAGTGGGGCTGGGGCTCTGTCCCCTGCTCTCTGTCCCTTTTCCTCCTTTCCTGGCACCCTTTCCAGGTCAACCCTTCCAGGTCACCCTTTTATCCCTAGACTAGCAAGATAGGGCCCCCGAAAAAGGGGTATGATGACCCCCCTGCCTACTTGGGGGAGAAACAGGTATAGGCCCCTTGGCCCCTTGGCCAAGGCTGTCTTAATCTCTGGGCTGCTACTAGTTCCAGAAAAACAAAGAGCCAGAAGTGCAGTAAAGGTAGTTTATTTTAAGAGGCTACCTCTCTCGGGGAGCAGGGGCTCCCTGGTGGCCTCCTTACCCCTGCCAAGCGGTCCTTCATTTAGAGGGGCTCATGCATCCTCTGCTCAGAGGCACTTTGGGGCACAAGTGCCCCCCTTGTCCAGGTATACAACTGGGCAGCACTCTCACAGGCCTTGGGACAGTTGGGGCTAACCAAGGCCAGCACAGGCGTAAGCTCCCTCTCCAGTGTACATACTATATCTATGTAACATTTTGTATATTCCAGGGGTAGGGCAGCCCCCTGTATCATAGCAGAGGTCGGAGCTGGCAGATGGGGAGCAGGTTCTATTAAATATTTGGGGTTGGGGGAACTTATTTATTGATAGCATAGGACAGAGGAAGGAGGCAGGGATAGGGTGGTGCCCAGGTGATTCGACTCCTGTTTGTTTTACTTTTTATTTCAGAATAAATGAATTTAGCCATA