Transcript asmbl_175010

Sequence
Transcript Sequence for observation asmbl_175010 of TGE0005878:
AGCTGGCTCCCAGCATGCCGCGCGCTGCTGACAGCCTTATAAATAGTCGCCTTTGCGGGCGGGTGGCTGGCGAGAACGGGCAGGGCACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGATCGGACAGCCCACGCTGCTGCTGTATGTGGACGCAGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGGGGTCAAGGTCAGGAGAGCCTCCCCGAGGAGGTGAGACCTGAAAGTCTTCCCACCATGTGGCCCTGGACAAGTCACAACCTGTCTTTCCTAAGGCCATTTCAAAATTTAAATTAGGCTCAGTGCCCAGCCCCCCCAGGTCAGGAAGAGAACTCACTAAACAGAGTGCGTAGGCTGTCAGGTACCGAGGCCCGTGGGAGCCAGAGGCCAGAGCAGCCTTGGGGATGTGCCAGGCTGGGGTGCTCTGGGGAGGCCCCAGAATCCCCTGGGGAGAACCATCTCTTCTTTTCTGTTCTTTCACTCTTTGACCTTGTCACGGAGAAAGGCTCCGTTTGGTGCTCACGTGTCCTAAACACCCACCCCAGCCCCAGCTGGCTCTCTTTAAAGCCAAGACAGCCCTGAGCGGGCCACACCTGGCTGGAACGGAACCCCATGTGGGCTGATTGTGCCTGTCATGTGTCCCTTCTATTTATAGCAAGCGTCGCTGCTTTTCCATTTACATTAGTTATTTAAACTTTCCTTTCAAATAAATATATTTAAGTTCTAAAAAGTGAGTCTATTGAAAGAAAAACATGAAAATAAAGAGGTGATAATACGGGGGAGAGAAGAGGAGGCCGGCGCCATGG