Transcript asmbl_170711

Sequence
Transcript Sequence for observation asmbl_170711 of TGE0005842:
GGCCTCACTGAGTGCTGCCGGGAGCCGCCACGCAGCCATGGAGGAGGAGGAGGAACAGCCACCTCAGGAGGCCCACGCAGAACCCCCTGTGACGTCAGGAGCGTCGGAGGTGGTGCCCAGGGTGCTTTCCGGAGAACCCCAGAACCTGTCTGACGTGGATGCTTTCAACCTGCTGCTGGAGATGAAGCTGAAGAGGCGGCGAGAACGGCCCCACCTGCCACGCACGGTGACAGAGCTGGTGGCCGAGGACGGGAGCAGAGTGTATGTGGTGGGCACAGCCCACTTCAGCGACGACAGCAAGAAGGACGTCGTGAAGACGATCCGGGCGGTGCAGCCGGACGTGGTGGTGGTGGAGCTCTGCCAGTACCGCGTGTCCATGCTGAAGATGGACGAGCGCACGCTGCTGCGGGAGGCCCGGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCCGTGCGGCAGAACGGGGTCATGTCTGGACTCATGCAGATGCTGCTGCTGAAGGTGTCGGCCCACATCACCGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAGGAGGCCAGCAAGGTGCCTTTCTGCAAGTTCCACTTGGGCGACCGGCCCATCCCCGTCACCTTCAAGAGGGCCATCGCCGCGCTGTCCTTCTGGCAGAAGGTCAAGCTGGCCTGGGGCCTGTGTTTCCTGTCAGACCCTATCAGCAAGGATGACGTGGAGCGATGCAAGCAGAAGGACCTGCTGGAGCAGATGATGGCGGAGATGGTCGGCGAGTTCCCCGACCTGCACCGCACCATCGTCTCCGAGCGCGACATCTACCTGACCTACATGCTGCGGCAGGCGGCCCGGCGCCTCGAGCTGCCGCGCTCCTCCGACGCTGAGCCCAGGAAGTGTGTCCCCTCTGTGGTGGTGGGCGTCGTGGGCATGGGCCACGTCCCCGGCATCGAGAAGAACTGGACCACTGACCTCAACATCCAGGAGATCATGACCGTCCCCCCGCCGTCCATCTCCGGCAGAGTGTCCCGGCTGGCTGTGAAGGTCGCCTTCTTGGGCCTGCTGGGCTATGGCCTGTACTGGATGGGGCGCCGCACCGCTGGCCTGGTCCTCTCGCTGCCTGCCACCCAGTACTGCCTGCAGAGGGCGTCCTCAGCCCGGCCGCACAAGTAGGAGGCGCACAGGGAGCCGCCACGCCTGAGGGGCCGTCCCCACGGGTCCGGGCCCAGCCTCGCCTGCCCTCCCCCAGCCCACCCAAATAAAGAATTATTTAACTGCTCTGAGCTCAGGCTCCCCAGCCCGCCCCCAGGGGCTGCTCACGGGTTCTCGGGCACCAGGACAGGCATCCGGGAGGGCCGAGGCCACGCTTCCCCGCCAGTCCCTCCCTGCCCTAGGTGGTCGGGCACGCTGGGCCACAGCCGGCAGTCCCCTCCCTCACTGTGCCTTCGGCTGTGCGTCAGCGCCTGGAGCGCCTGGCCTGGCGGCTTGGGCTGGGAGGGCGAGAGCACCCAGGCTCTGGCCTGGCCCCTGGGAGTAGTCCTCCCAGGGGAGCAGCTTGGCCAAGCCTGGCGGCCTGGCGGCCGGATGTGCACCAGCACCGCTCTGCCTGCAGAGGTGTGTGTTCTTGGCTTTTAAAAATATCTGAAATTTTTTACTCAGGTAACTTTAACTTAAACAAAGTGAAGCAATGTCAGGAAATACGAGCCTTAAATCTGGTTGGGACAGGGAGGACGGCTTTCCCTCGGGATCCCCGAGAGAATGAGCGTGCAGGCAGGTCCAGCCCTGGCACCAAGGGCCCCTCCAGCTGCCCCCGTGGCCTGCTTCCAGCTCCTGGGGGTCCAGCAGTGAGCCTGTCTGGATGCAGGGGTCACACCTACTGCTTGCGCATCTGGTCGGGAGACCTGCAGGTCTCCCCTACCCTCAGTGGACAGATGGTGTGTGTCCGCCAGGGCCCACCAGTTTGCACGTGTGCCTGCAGGCGCCCACCGCCCTCTCGTATGCCCACCTCAGGGTGCTGCAGACAGGAGCTCGAGGCCGGGCTGGCCCCTGGTCATTGCCCTGTGCACAGTCACCTGGTCCTGGTCGTCAGTTTAGGACGAGGCGTCCGCGTAGCCCAGCTGGGCCACGTTTGACTGTCTGCTGACTCGGTGTGTTACCAAATCAGGGGAAACCCACAGCCACGCAGGGCTAGGGAACCTCGGGCTGGACCATGTCCCTCCTGCCATTCATGTACTGTTCCTCAGAAACAAATAAAAGCTACTTTTGGAA